ID: 990181410

View in Genome Browser
Species Human (GRCh38)
Location 5:53164638-53164660
Sequence CAGTACCAGGAGGGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990181403_990181410 14 Left 990181403 5:53164601-53164623 CCTCACCTTTGTTTGCACTGGAC No data
Right 990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG No data
990181404_990181410 9 Left 990181404 5:53164606-53164628 CCTTTGTTTGCACTGGACTCAAG No data
Right 990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990181410 Original CRISPR CAGTACCAGGAGGGGTGGTC AGG Intergenic
No off target data available for this crispr