ID: 990181410 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:53164638-53164660 |
Sequence | CAGTACCAGGAGGGGTGGTC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990181403_990181410 | 14 | Left | 990181403 | 5:53164601-53164623 | CCTCACCTTTGTTTGCACTGGAC | No data | ||
Right | 990181410 | 5:53164638-53164660 | CAGTACCAGGAGGGGTGGTCAGG | No data | ||||
990181404_990181410 | 9 | Left | 990181404 | 5:53164606-53164628 | CCTTTGTTTGCACTGGACTCAAG | No data | ||
Right | 990181410 | 5:53164638-53164660 | CAGTACCAGGAGGGGTGGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990181410 | Original CRISPR | CAGTACCAGGAGGGGTGGTC AGG | Intergenic | ||
No off target data available for this crispr |