ID: 990184216

View in Genome Browser
Species Human (GRCh38)
Location 5:53195736-53195758
Sequence AGGGAAGAGTAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990184212_990184216 11 Left 990184212 5:53195702-53195724 CCAGGGCAGGAAAAGAGGAATAA No data
Right 990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990184216 Original CRISPR AGGGAAGAGTAGAAGCAGGA AGG Intergenic
No off target data available for this crispr