ID: 990203045

View in Genome Browser
Species Human (GRCh38)
Location 5:53399184-53399206
Sequence GTGGTCAGAAGGAGAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990203037_990203045 29 Left 990203037 5:53399132-53399154 CCAGCACATGCCTGGATGATTTA No data
Right 990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG No data
990203042_990203045 -8 Left 990203042 5:53399169-53399191 CCTAGTATTGGTCTAGTGGTCAG No data
Right 990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG No data
990203039_990203045 19 Left 990203039 5:53399142-53399164 CCTGGATGATTTAGGCTTAAATG No data
Right 990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG No data
990203036_990203045 30 Left 990203036 5:53399131-53399153 CCCAGCACATGCCTGGATGATTT No data
Right 990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990203045 Original CRISPR GTGGTCAGAAGGAGAATTGA GGG Intergenic
No off target data available for this crispr