ID: 990204493

View in Genome Browser
Species Human (GRCh38)
Location 5:53414244-53414266
Sequence GCTGTTCTAATGCTTCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990204493_990204500 26 Left 990204493 5:53414244-53414266 CCAACAAGAAGCATTAGAACAGC 0: 1
1: 0
2: 4
3: 16
4: 141
Right 990204500 5:53414293-53414315 AATTACCTCCCATGACACGTGGG No data
990204493_990204499 25 Left 990204493 5:53414244-53414266 CCAACAAGAAGCATTAGAACAGC 0: 1
1: 0
2: 4
3: 16
4: 141
Right 990204499 5:53414292-53414314 CAATTACCTCCCATGACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990204493 Original CRISPR GCTGTTCTAATGCTTCTTGT TGG (reversed) Intergenic
903296868 1:22349399-22349421 GCAGTCCTAATGCTCCTTGCTGG + Intergenic
905589809 1:39153540-39153562 GCTCTTTTAAAGCCTCTTGTTGG + Intronic
909674644 1:78225673-78225695 GCAGTTTTATTTCTTCTTGTTGG + Intergenic
914252395 1:145932397-145932419 GATGTTTTAGAGCTTCTTGTGGG + Intergenic
914783436 1:150806689-150806711 GTTGTTATATTGCTTCCTGTGGG + Exonic
917550560 1:176023204-176023226 GCTGTTGTAGTTCTTATTGTTGG - Intronic
917680854 1:177365938-177365960 CCTGTTCTTATGATTCTCGTAGG + Intergenic
921425664 1:214998280-214998302 GCTTTTCTAATTCCTCTGGTTGG + Intergenic
922055871 1:222041957-222041979 GCTGTTCTAAGGATCCTTGAAGG - Intergenic
923093574 1:230757577-230757599 GATGTTCTAGTTCTTATTGTGGG - Intronic
924097560 1:240569609-240569631 GCTGTTCCAATACTATTTGTTGG - Intronic
1064003238 10:11680878-11680900 GGTGTTTTAAGGCTTCTTGGAGG - Intergenic
1066359597 10:34717356-34717378 GCTGTTTTATTTCTACTTGTGGG - Intronic
1067306986 10:45073135-45073157 TTTGTTCTAATGCTTCTTGTTGG + Intergenic
1068507605 10:57922326-57922348 GCTATACTCATGTTTCTTGTCGG + Intergenic
1068999400 10:63246311-63246333 ACTTTTCTCATGCTTCTTTTAGG - Intronic
1070976388 10:80609211-80609233 GCTGTTTTAATCCTCTTTGTAGG + Intronic
1071145166 10:82561188-82561210 GTTGTTTTAATGCCTCTTGGGGG + Intronic
1072402829 10:95122707-95122729 GCTGTTTTTATTCTTCTGGTTGG + Intergenic
1073975879 10:109100534-109100556 GTTATTCTAATGCTTGTTTTAGG + Intergenic
1074079886 10:110159103-110159125 CTTCTTCTAAAGCTTCTTGTTGG + Intergenic
1076911250 10:133391202-133391224 GCTGTTTTCCTGCTTCTTGGTGG + Intronic
1077800949 11:5536117-5536139 GCTTTTCTAATGTTTGTAGTAGG - Intronic
1082723005 11:56701757-56701779 TTTGTGCTAATTCTTCTTGTGGG - Intergenic
1083541344 11:63513594-63513616 GCTGTGCTAAATCTTCATGTTGG - Intronic
1086592873 11:88536558-88536580 GCTGTTATAAAGCTTTGTGTTGG - Intronic
1086873715 11:92070385-92070407 GCACTTCTCATGCTTCCTGTGGG - Intergenic
1087620557 11:100536632-100536654 AATGTGCTAATGCTTTTTGTGGG - Intergenic
1094165548 12:27439085-27439107 ACAGTCCTAATGCTACTTGTGGG - Intergenic
1101658255 12:106743245-106743267 ACAATTCTAATGCTTTTTGTCGG - Intronic
1103427549 12:120850101-120850123 ACTGTTCTAAAGCAACTTGTTGG + Intronic
1103973298 12:124685942-124685964 GCTTATCTAGTGCTTCCTGTGGG + Intergenic
1104357104 12:128096853-128096875 GATGTTCTAACGCCTCTTGAGGG + Intergenic
1106426342 13:29634400-29634422 GCTGTTGTTTTGATTCTTGTTGG + Intergenic
1107952863 13:45480254-45480276 GCTGTTCACAGGCTTCATGTAGG - Exonic
1109497226 13:63188727-63188749 GCTATGCTGATGCTGCTTGTTGG + Intergenic
1110733973 13:78912877-78912899 GCAGTTCTAGTGCTTCTAGGGGG + Intergenic
1115241406 14:31253944-31253966 AATGCGCTAATGCTTCTTGTTGG + Intergenic
1115559280 14:34568683-34568705 TTTGTTCTAATGCTTCTTGTTGG + Intronic
1115721964 14:36171947-36171969 GCTTTGCTATTGCTTCTAGTTGG - Intergenic
1118219460 14:63841332-63841354 GCTGTCCTCATGCTGCTTGGGGG + Intergenic
1119465469 14:74854558-74854580 GCAGTTCTAAAGCTTCTGTTTGG + Exonic
1119560361 14:75584658-75584680 ACTGCTCTAATGCTTCCTGGAGG + Intronic
1119631477 14:76236090-76236112 TATGTTCTAAAGCTTTTTGTTGG - Intronic
1126418517 15:48445286-48445308 TCTGTTCTAATGCTTCTTTCTGG - Intronic
1127337990 15:58009195-58009217 GCTGTTGTGATGCCTCATGTAGG - Intronic
1129534480 15:76300935-76300957 ACTGTACTAATGCTTTTTGGAGG - Intronic
1129558944 15:76545198-76545220 GATGCTCTAATGGTTATTGTGGG + Intronic
1138110144 16:54317320-54317342 ACTGTTGTAATGCATTTTGTTGG - Intergenic
1140479233 16:75253528-75253550 GCTGTTCTAATGCAGCTACTGGG - Intronic
1141632248 16:85294500-85294522 GCTGTTCTTTTGCCTCATGTTGG + Intergenic
1142922261 17:3199425-3199447 ACTGTTTAAATGCTTCTGGTTGG + Intergenic
1148361778 17:47017906-47017928 GCTGTGCTGGGGCTTCTTGTTGG - Intronic
1150386394 17:64765056-64765078 GCTGTTTTACTCCTTTTTGTGGG + Intergenic
1151092401 17:71457650-71457672 AATATTCTAATGCTTCTTATTGG - Intergenic
1152071100 17:78133966-78133988 GCTGATCTCATGCTTCTTGATGG - Exonic
1153339907 18:3962920-3962942 GTTGATTTGATGCTTCTTGTAGG + Intronic
1160028750 18:75240682-75240704 GCTCCTCTGATGCTTCTGGTTGG + Intronic
1160252848 18:77218784-77218806 GCTGTGGTGATGCTTCCTGTTGG + Intergenic
1162265726 19:9572417-9572439 GCATTTGTAATGCTTCCTGTGGG - Intronic
1162277216 19:9665459-9665481 GCTCTTGTGATGCTTCCTGTGGG - Intronic
1166292363 19:41871361-41871383 TTTGTTCTAATGCTTCTTGTTGG - Exonic
1167210237 19:48129621-48129643 CCTGTTCTAGAGCTTCCTGTTGG - Intronic
928155262 2:28870678-28870700 GCTGTACTCATACATCTTGTGGG - Intergenic
928305524 2:30167270-30167292 GCTGTTCTAACACACCTTGTGGG - Intergenic
929255016 2:39801259-39801281 ACTTTTCTAAGTCTTCTTGTGGG + Intergenic
930943404 2:57041208-57041230 GCTCTTCTGATGCTTCCTGTCGG + Intergenic
939468042 2:142583460-142583482 GCTGTACTGATGCCCCTTGTGGG + Intergenic
941207808 2:162595827-162595849 GCTGTTCTAACATTTCTTGGTGG - Intronic
941610559 2:167656694-167656716 GCTGTCCTACAGCTTATTGTTGG + Intergenic
944379075 2:199086241-199086263 GATGTTTTAAAGCTGCTTGTGGG + Intergenic
945402501 2:209402685-209402707 GCTGTTCTCATTCTTCTTGAAGG - Intergenic
945713988 2:213335946-213335968 GCTGTTTTCATCCTTCTTGGTGG - Intronic
1169992918 20:11523451-11523473 TCTATTCTATTGCTTCTTTTAGG - Intergenic
1170678642 20:18505053-18505075 TTTGTTCCAATGCTTCTTGTTGG - Intergenic
1174049422 20:47757375-47757397 GCTGATCTGGTGCTTCTTTTGGG + Exonic
1174869447 20:54169449-54169471 GCCCTTTTAATGCTTCTTTTAGG - Intronic
1177234724 21:18373713-18373735 GCTGTCCTAATGCTTCTCATGGG + Intronic
1178643320 21:34364086-34364108 GCTGTTCTGAACCTTCTTGCTGG - Exonic
1183465687 22:37979407-37979429 GCTTTTCTAATGCTGCTTGCGGG + Intronic
952577339 3:34791063-34791085 GCTGTCCTCTTGCTTCTTCTGGG + Intergenic
955457121 3:59135440-59135462 TCTGTTCTAATTGTTTTTGTAGG + Intergenic
956133962 3:66080927-66080949 GCTGCTCTAACGCTGCTGGTGGG + Intergenic
956374801 3:68603135-68603157 GCTGTTTTCATTCTTCTTATTGG - Intergenic
957109803 3:75939479-75939501 GCTGTAGTAAAGCTTCTAGTGGG + Intronic
957190353 3:77000300-77000322 GCTGTTTTAATGATTCTTATAGG - Intronic
959081811 3:101810060-101810082 GCAGTGCTACTGCTACTTGTGGG + Intronic
959259845 3:104063354-104063376 GATGTTCCAATGATTCTGGTCGG + Intergenic
963360940 3:144271269-144271291 GCTGTTCTAATTCCTCTGGGGGG - Intergenic
963491712 3:146009676-146009698 GCTGTTCTCATGATAGTTGTAGG + Intergenic
964896190 3:161599132-161599154 TCTGTTCTAATTGTTCATGTGGG + Intergenic
966466943 3:180239915-180239937 TTTCTTATAATGCTTCTTGTTGG - Intergenic
966749645 3:183309835-183309857 ACTGTTCTAATGTTTCTTGTAGG - Exonic
969879948 4:10164479-10164501 GCTGCTCTGATGCTGCTTGCAGG + Intergenic
969885162 4:10208979-10209001 GCCGTTCTAATGCTGTTTCTCGG + Intergenic
970783559 4:19768472-19768494 GCTGTTTTAGTCCTTCTTGGTGG + Intergenic
972257988 4:37379558-37379580 GATTTTATAATGCTTTTTGTTGG + Intronic
972396232 4:38662102-38662124 GCTGCTCAAATGCAACTTGTCGG - Intergenic
972596748 4:40536139-40536161 GCTGTTCTACTGCTACTTCTTGG + Intronic
975910492 4:79260433-79260455 GCCAATCAAATGCTTCTTGTTGG - Intronic
976611906 4:87039291-87039313 ACTTTTCAAATGCTTCTTGGGGG - Intronic
979439099 4:120729882-120729904 CCTGTTCTGATGTTTCTTGCTGG - Intronic
980378721 4:131981330-131981352 GCTGTTCTATTTTGTCTTGTTGG + Intergenic
981900668 4:149858235-149858257 GCACTTGTAATGCTTCATGTGGG - Intergenic
984083648 4:175281441-175281463 AATGTTCTAATACTGCTTGTTGG - Intergenic
988076682 5:26363127-26363149 GCTGTTTTAGTTCTTCTTGGTGG + Intergenic
989305495 5:39950842-39950864 GCTGTTTTTATTCTTCTTGATGG - Intergenic
990204493 5:53414244-53414266 GCTGTTCTAATGCTTCTTGTTGG - Intergenic
990307761 5:54509857-54509879 GTTGTTCCAATGTTTCATGTTGG - Intergenic
992374380 5:76173840-76173862 GATGTTCCAATGATTCTTGTTGG - Intronic
992493272 5:77266785-77266807 GCTCTTATAATTCTTCATGTTGG + Intronic
995466023 5:112450153-112450175 CCTGTTCTATTTCTTCTTCTGGG - Intergenic
996245651 5:121261215-121261237 GATGATCTAATACTGCTTGTGGG + Intergenic
997033816 5:130162742-130162764 TCTGCTCCAATGCTTCTAGTTGG - Intronic
997334964 5:133100968-133100990 GCTGTTTTAATTTTTTTTGTAGG + Intronic
999757619 5:154676831-154676853 ATTGTTCTAGTGCTTTTTGTTGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001869606 5:175139613-175139635 GCCGTTAAAATGCTTTTTGTGGG - Intergenic
1006981743 6:38153290-38153312 GCACTTCTACTGATTCTTGTTGG - Exonic
1007220907 6:40278019-40278041 GCTGTTCTAACACCTCTTGAAGG + Intergenic
1012320088 6:97832735-97832757 TCTGGTCTAATGCATCTTATTGG - Intergenic
1012483278 6:99691458-99691480 GCTTTTCTCTTGCTGCTTGTAGG - Intergenic
1013482157 6:110562169-110562191 TTTGTTTTAATGCTTCTTGTTGG + Intergenic
1013601824 6:111712356-111712378 GCTGTTATTTTGCTGCTTGTTGG - Intronic
1014186339 6:118438585-118438607 CATGTTCTAATTTTTCTTGTGGG - Intergenic
1015170788 6:130250169-130250191 GCTGTGCTTATGCCTCTTTTTGG - Intronic
1016238106 6:141892487-141892509 GCTTTTATAATGCTGCTGGTAGG + Intergenic
1018451504 6:163912305-163912327 TCTTTTCTAATTCTTTTTGTGGG + Intergenic
1021717514 7:23473494-23473516 ACTGTACAAATGTTTCTTGTGGG + Intergenic
1022184403 7:27953224-27953246 GCTGTTCTAATCTTACCTGTAGG + Intronic
1024297196 7:47854247-47854269 ACTGTTCTACTGCTCCTGGTTGG - Intronic
1024554779 7:50593913-50593935 GCTGTTCTTTTGTTACTTGTAGG + Intronic
1025743968 7:64226653-64226675 TATGTTCCAATGCTTCCTGTAGG + Intronic
1025751187 7:64295068-64295090 TATGTTCCAATGCTTCCTGTAGG + Intergenic
1031558327 7:123206205-123206227 ACTGTTCTAATTCTGCTTCTTGG + Intergenic
1033611589 7:142968429-142968451 GTTGTTCCTATACTTCTTGTTGG + Intergenic
1035784717 8:2251507-2251529 GCTGTTCTAATACTCCTTTTTGG - Intergenic
1035808090 8:2470206-2470228 GCTGTTCTAATACTCCTTTTTGG + Intergenic
1041479470 8:58302743-58302765 TTTGTTCTCATGCTTCTTGCAGG - Intergenic
1042178946 8:66065572-66065594 ACTGTACTCAAGCTTCTTGTGGG + Intronic
1048274150 8:133053193-133053215 GCTGTACTAATTCTTCCTCTTGG + Intronic
1048612816 8:136042204-136042226 GCTGTTTGAATGCTACTTGTTGG + Intergenic
1051585023 9:18718185-18718207 GATGTTCCAATGATTCTTGTTGG - Intronic
1051700186 9:19814090-19814112 GCTTTTCTAATGGTTCTTATTGG + Intergenic
1053729802 9:41041872-41041894 GCTGTTCTGTTCTTTCTTGTTGG - Intergenic
1054698706 9:68390191-68390213 GCTGTTCTGTTCTTTCTTGTTGG + Intronic
1055863367 9:80782326-80782348 TTTATTCTAATGCTTCCTGTTGG + Intergenic
1057334427 9:94144607-94144629 GGTGTTCTAATGCTCATTCTTGG - Intergenic
1057429971 9:94984744-94984766 GCTGTTCTAAAGCTATTAGTTGG + Intronic
1059999704 9:119947073-119947095 GGTGTACTAATGCTTTTTATGGG - Intergenic
1060607308 9:124927025-124927047 GCTGTTCTGATGCAGCTTTTTGG + Intronic
1062091448 9:134680673-134680695 GCTGTTCTAATGCACCATGATGG + Intronic
1062117588 9:134817756-134817778 GCTGTTCTCTTGCTTCTTTCAGG + Exonic
1187727874 X:22222658-22222680 GCTGTTCTATTGTTTTTTGGGGG - Intronic
1190416088 X:50181824-50181846 GCTGTTCTCATTCTTCTTTGTGG + Intergenic
1191028645 X:55943251-55943273 GCTGCTCTAGTGCTTCTACTTGG - Intergenic
1193598678 X:83481167-83481189 GCGGTTACAATGCTTCCTGTAGG - Intergenic
1194573902 X:95587500-95587522 GCTGTTGTGCTGTTTCTTGTTGG + Intergenic
1196167852 X:112555237-112555259 GCTGTTTTCATTCTTCTTGGTGG - Intergenic
1196415353 X:115465273-115465295 GTTGGTATAATGCTTATTGTTGG + Intergenic
1198381049 X:136083909-136083931 CCTGTTTTAATGCTGCTTGAAGG + Intergenic
1200896829 Y:8384703-8384725 TATGTTCCAATGCTTCCTGTGGG + Intergenic