ID: 990205203

View in Genome Browser
Species Human (GRCh38)
Location 5:53421426-53421448
Sequence ATGTTGTTGTTAAAGACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990205203_990205204 13 Left 990205203 5:53421426-53421448 CCTGTTGTCTTTAACAACAACAT No data
Right 990205204 5:53421462-53421484 AAGAAAGCAAAAAAATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990205203 Original CRISPR ATGTTGTTGTTAAAGACAAC AGG (reversed) Intergenic
No off target data available for this crispr