ID: 990206188

View in Genome Browser
Species Human (GRCh38)
Location 5:53432109-53432131
Sequence ATGTATTTCTTAAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990206188_990206192 20 Left 990206188 5:53432109-53432131 CCATTTTCCCTTAAGAAATACAT No data
Right 990206192 5:53432152-53432174 TTCTACTAAAACCATGCCAAGGG No data
990206188_990206191 19 Left 990206188 5:53432109-53432131 CCATTTTCCCTTAAGAAATACAT No data
Right 990206191 5:53432151-53432173 TTTCTACTAAAACCATGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990206188 Original CRISPR ATGTATTTCTTAAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr