ID: 990207936

View in Genome Browser
Species Human (GRCh38)
Location 5:53450422-53450444
Sequence AGATCCACAAAGGTTTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990207936_990207940 22 Left 990207936 5:53450422-53450444 CCTAGCTAAACCTTTGTGGATCT No data
Right 990207940 5:53450467-53450489 TCCCTTGAGGCATTTCCCATTGG No data
990207936_990207939 9 Left 990207936 5:53450422-53450444 CCTAGCTAAACCTTTGTGGATCT No data
Right 990207939 5:53450454-53450476 ACATATCACTTGTTCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990207936 Original CRISPR AGATCCACAAAGGTTTAGCT AGG (reversed) Intergenic
No off target data available for this crispr