ID: 990210128

View in Genome Browser
Species Human (GRCh38)
Location 5:53473924-53473946
Sequence AACAAGTATCAGCCTACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210127_990210128 7 Left 990210127 5:53473894-53473916 CCATAGACAATCAGCTTGGGGAA No data
Right 990210128 5:53473924-53473946 AACAAGTATCAGCCTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210128 Original CRISPR AACAAGTATCAGCCTACACC AGG Intergenic
No off target data available for this crispr