ID: 990210630

View in Genome Browser
Species Human (GRCh38)
Location 5:53479488-53479510
Sequence CATTCTTCGCTGAAAGTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210630_990210634 4 Left 990210630 5:53479488-53479510 CCGCCAACTTTCAGCGAAGAATG No data
Right 990210634 5:53479515-53479537 GCACTGTACTTAATAAACTGAGG No data
990210630_990210635 23 Left 990210630 5:53479488-53479510 CCGCCAACTTTCAGCGAAGAATG No data
Right 990210635 5:53479534-53479556 GAGGCTACAGAAGTTCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210630 Original CRISPR CATTCTTCGCTGAAAGTTGG CGG (reversed) Intergenic
No off target data available for this crispr