ID: 990210630 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:53479488-53479510 |
| Sequence | CATTCTTCGCTGAAAGTTGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990210630_990210634 | 4 | Left | 990210630 | 5:53479488-53479510 | CCGCCAACTTTCAGCGAAGAATG | No data | ||
| Right | 990210634 | 5:53479515-53479537 | GCACTGTACTTAATAAACTGAGG | No data | ||||
| 990210630_990210635 | 23 | Left | 990210630 | 5:53479488-53479510 | CCGCCAACTTTCAGCGAAGAATG | No data | ||
| Right | 990210635 | 5:53479534-53479556 | GAGGCTACAGAAGTTCATTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990210630 | Original CRISPR | CATTCTTCGCTGAAAGTTGG CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||