ID: 990210746

View in Genome Browser
Species Human (GRCh38)
Location 5:53480040-53480062
Sequence CTGCCCAAATATCCCGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210746_990210757 22 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210757 5:53480085-53480107 CAAAAGTCTCTTTGGAGCGGAGG No data
990210746_990210754 14 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210754 5:53480077-53480099 GCCGTTTGCAAAAGTCTCTTTGG No data
990210746_990210758 27 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG No data
990210746_990210751 -8 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210746_990210756 19 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210746 Original CRISPR CTGCCCAAATATCCCGCCCC GGG (reversed) Intergenic
No off target data available for this crispr