ID: 990210751

View in Genome Browser
Species Human (GRCh38)
Location 5:53480055-53480077
Sequence TTGGGCAGCCCGGGGCTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210747_990210751 -9 Left 990210747 5:53480041-53480063 CCGGGGCGGGATATTTGGGCAGC No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210732_990210751 28 Left 990210732 5:53480004-53480026 CCGGAACCGCCGCGAGGCCGGCG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210733_990210751 22 Left 990210733 5:53480010-53480032 CCGCCGCGAGGCCGGCGCGCTCC No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210746_990210751 -8 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210731_990210751 29 Left 990210731 5:53480003-53480025 CCCGGAACCGCCGCGAGGCCGGC No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210743_990210751 -4 Left 990210743 5:53480036-53480058 CCGACCCGGGGCGGGATATTTGG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210734_990210751 19 Left 990210734 5:53480013-53480035 CCGCGAGGCCGGCGCGCTCCGAC No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210741_990210751 1 Left 990210741 5:53480031-53480053 CCGACCCGACCCGGGGCGGGATA No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210735_990210751 11 Left 990210735 5:53480021-53480043 CCGGCGCGCTCCGACCCGACCCG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data
990210742_990210751 -3 Left 990210742 5:53480035-53480057 CCCGACCCGGGGCGGGATATTTG No data
Right 990210751 5:53480055-53480077 TTGGGCAGCCCGGGGCTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210751 Original CRISPR TTGGGCAGCCCGGGGCTCTT CGG Intergenic
No off target data available for this crispr