ID: 990210756

View in Genome Browser
Species Human (GRCh38)
Location 5:53480082-53480104
Sequence TTGCAAAAGTCTCTTTGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210746_990210756 19 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210741_990210756 28 Left 990210741 5:53480031-53480053 CCGACCCGACCCGGGGCGGGATA No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210752_990210756 -4 Left 990210752 5:53480063-53480085 CCCGGGGCTCTTCGGCCGTTTGC No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210743_990210756 23 Left 990210743 5:53480036-53480058 CCGACCCGGGGCGGGATATTTGG No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210742_990210756 24 Left 990210742 5:53480035-53480057 CCCGACCCGGGGCGGGATATTTG No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210747_990210756 18 Left 990210747 5:53480041-53480063 CCGGGGCGGGATATTTGGGCAGC No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data
990210753_990210756 -5 Left 990210753 5:53480064-53480086 CCGGGGCTCTTCGGCCGTTTGCA No data
Right 990210756 5:53480082-53480104 TTGCAAAAGTCTCTTTGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210756 Original CRISPR TTGCAAAAGTCTCTTTGGAG CGG Intergenic
No off target data available for this crispr