ID: 990210758

View in Genome Browser
Species Human (GRCh38)
Location 5:53480090-53480112
Sequence GTCTCTTTGGAGCGGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990210753_990210758 3 Left 990210753 5:53480064-53480086 CCGGGGCTCTTCGGCCGTTTGCA No data
Right 990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG No data
990210747_990210758 26 Left 990210747 5:53480041-53480063 CCGGGGCGGGATATTTGGGCAGC No data
Right 990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG No data
990210752_990210758 4 Left 990210752 5:53480063-53480085 CCCGGGGCTCTTCGGCCGTTTGC No data
Right 990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG No data
990210746_990210758 27 Left 990210746 5:53480040-53480062 CCCGGGGCGGGATATTTGGGCAG No data
Right 990210758 5:53480090-53480112 GTCTCTTTGGAGCGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990210758 Original CRISPR GTCTCTTTGGAGCGGAGGAG AGG Intergenic
No off target data available for this crispr