ID: 990219989

View in Genome Browser
Species Human (GRCh38)
Location 5:53577391-53577413
Sequence CTGAAATGACACATGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990219986_990219989 -10 Left 990219986 5:53577378-53577400 CCTGCAGCTGTGGCTGAAATGAC 0: 1
1: 0
2: 2
3: 26
4: 261
Right 990219989 5:53577391-53577413 CTGAAATGACACATGGGCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990219989 Original CRISPR CTGAAATGACACATGGGCCA AGG Intronic
901558132 1:10047784-10047806 AAGTAATGACATATGGGCCAAGG - Intronic
902155177 1:14479264-14479286 CTTAAATCAGACATGGGCTAAGG + Intergenic
902731805 1:18374629-18374651 CTGAAATGCCACATGGGTCTAGG - Intronic
903032249 1:20472329-20472351 CAGCAATGACACATGGGCCTTGG + Intergenic
904834161 1:33324238-33324260 CTGGACTGACAGATAGGCCAAGG - Exonic
905314377 1:37072302-37072324 GTGAGATGACACATGGGAGAGGG - Intergenic
905632573 1:39526869-39526891 CTGACATGAGCCATGGGCAAGGG - Intergenic
908830831 1:68176684-68176706 CTGAAATAACATATGTGCAAAGG - Intronic
908965405 1:69755997-69756019 CTCAAATAACACAGGGACCAAGG + Intronic
909155818 1:72075051-72075073 CTGATATGACACTTGAACCATGG + Intronic
909359910 1:74748005-74748027 CTGAAATGCCAGCTGTGCCATGG - Intronic
911808427 1:102242190-102242212 AGGAACTGACACATGGCCCATGG - Intergenic
914509830 1:148321674-148321696 CTGAAAAGACACATGTGGCAGGG + Intergenic
915538334 1:156551328-156551350 ATGAATTGACAAATGGGGCAGGG - Intronic
915582329 1:156821919-156821941 CAAACATCACACATGGGCCATGG - Intronic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918200373 1:182260742-182260764 CTGAAATGACCCATGAGCTAAGG + Intergenic
924085015 1:240442092-240442114 TTGAAAAGACACATGGATCACGG - Intronic
924424747 1:243940966-243940988 CTCAAGTGACACATGGGAAATGG - Intergenic
1064572085 10:16704270-16704292 CTGAAATGACACCTGGTACATGG - Intronic
1068647843 10:59488710-59488732 ATAAAATGACACAAAGGCCAGGG - Intergenic
1069754378 10:70764229-70764251 CTGAAATGACACAGCAGGCAGGG + Intergenic
1069842080 10:71346176-71346198 CTGAAAGTACTCCTGGGCCATGG + Intronic
1072625570 10:97108941-97108963 CTGAGATCACACATGGGCCCAGG + Intronic
1073566264 10:104538136-104538158 CTGCAATGATCCATAGGCCATGG + Intergenic
1073574276 10:104608676-104608698 GTGCAAGGACACATGGCCCAAGG + Intergenic
1073735499 10:106341242-106341264 CTGAAATGCTACATGGGCAAGGG - Intergenic
1073942438 10:108713876-108713898 CTGAAAAGACACAGGGCCAAAGG + Intergenic
1076107701 10:127836415-127836437 CTGCCATCACACATGGGCCTCGG - Intergenic
1078049008 11:7945697-7945719 CTGAAGTGACACATTGCCCCTGG - Intergenic
1080499138 11:32852031-32852053 ATGAAATGCAACATGGGCCTGGG - Intronic
1081711924 11:45222679-45222701 CTGAAGTCAAACATGGGGCAGGG + Intronic
1082920753 11:58490802-58490824 CTGTAATTACACATGGGGCAGGG + Intergenic
1086404392 11:86487575-86487597 CAGAAATGACACCTGGGCGGGGG - Intronic
1087064213 11:94011998-94012020 CTGCAAAGAAATATGGGCCAGGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1091390622 12:124039-124061 ATGAAATAACACATAGGCCCTGG + Intronic
1092131372 12:6115607-6115629 CTGAACTGAGTCATGGGCCATGG - Intronic
1094307798 12:29040260-29040282 CTGAAATCAGAGGTGGGCCAGGG + Intergenic
1094423914 12:30299451-30299473 CTGAAATGAGACCTATGCCAGGG + Intergenic
1095509027 12:42929255-42929277 CTGAAAAGAGATATGGCCCAGGG - Intergenic
1096591422 12:52662380-52662402 GTGAAATGACACATGCAACAGGG - Intergenic
1101369885 12:104117166-104117188 GTTAAATGCAACATGGGCCAAGG + Exonic
1101426934 12:104595715-104595737 ATGAAATGGCACCTGGTCCATGG - Intronic
1105575058 13:21643085-21643107 CAGAAATGAAACATGGGTGAAGG + Intergenic
1106081906 13:26507298-26507320 CTGAAATCAAACATGCGCTAAGG - Intergenic
1109697526 13:65979391-65979413 ATGAACTGAGACATAGGCCAGGG - Intergenic
1111671818 13:91340694-91340716 CTCAAATGACACACGGACAATGG + Intergenic
1116175187 14:41460440-41460462 CTGAAGTGATTCATTGGCCAAGG + Intergenic
1117937195 14:60919691-60919713 CTGAACTTACACATGGGTGATGG - Intronic
1118517965 14:66547449-66547471 GTCATATGACGCATGGGCCAAGG + Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1121605581 14:95237634-95237656 GGGAAATGACACCTGGGGCATGG - Intronic
1121976483 14:98408797-98408819 CTGAAATGTCACAGGGGCATGGG - Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1124583263 15:30981420-30981442 CTCACATGACACAAGGGCAAAGG + Intronic
1125107319 15:35987785-35987807 CTGAAATGAAAAATGGCACATGG - Intergenic
1126040338 15:44584397-44584419 CTCACATGCCACATGGGCCTGGG + Exonic
1126042655 15:44607649-44607671 TTGAAATGAGAAATGGGCAAAGG + Intronic
1126410045 15:48363937-48363959 GTGAAATGAGAGATTGGCCAGGG + Intergenic
1129822863 15:78616600-78616622 CTGGAAAGATCCATGGGCCAAGG - Intronic
1130888121 15:88110783-88110805 CTGAAATGAAAATTGGGCCCAGG - Intronic
1130942505 15:88523243-88523265 CTGAAATGACTCATGATCCTTGG + Intronic
1131605932 15:93902211-93902233 CTGAAATGAAACAGGGACCATGG + Intergenic
1132635848 16:946140-946162 TGCAAATGACACATGGGACATGG + Intronic
1137254112 16:46760971-46760993 TTGGAATGACACAGTGGCCAGGG + Intronic
1137451494 16:48578513-48578535 CTGAAAGGCAACTTGGGCCAAGG - Intronic
1139729180 16:68928098-68928120 CTGTAAAGACACATGGGCACAGG + Intronic
1141273492 16:82562355-82562377 CTGATTTGACTCATAGGCCATGG - Intergenic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1142111520 16:88334428-88334450 CTGAAATCAGACATGCTCCAGGG + Intergenic
1142811581 17:2397940-2397962 CTGCAGTGACCCAGGGGCCAAGG + Intronic
1143484181 17:7244006-7244028 CTGGATGGACACATGGGCCAGGG - Exonic
1144409487 17:14986661-14986683 TTGAAATTAGAGATGGGCCAAGG + Intergenic
1147276544 17:39322191-39322213 CTGAAATTAAGCATGGGGCATGG - Intronic
1150012887 17:61522876-61522898 CTTAAATAACCAATGGGCCAAGG - Intergenic
1151823811 17:76512526-76512548 CTGGAGTGACATCTGGGCCAAGG - Intergenic
1151946185 17:77321205-77321227 CTGAAGTGACCTACGGGCCATGG + Intronic
1152249753 17:79205963-79205985 CTGGAATGTCACAACGGCCAAGG - Intronic
1153045345 18:850783-850805 TTGAAATTAAACATGGGCCAGGG - Intergenic
1154123381 18:11669672-11669694 CTGAAATGAGGAAAGGGCCAAGG - Intergenic
1155435222 18:25805682-25805704 CTGAAAAGACCCATGTGGCAAGG + Intergenic
1156482955 18:37447650-37447672 CTGTGATGCCACATGGGCCCTGG + Intronic
1156875548 18:42006216-42006238 TTGAAATGACACATGGGTTGAGG + Intronic
1161455488 19:4367766-4367788 CTGAAATGTCCCATGGAACATGG + Intronic
1161941818 19:7409663-7409685 CTGAACTCACACTTGAGCCAAGG + Intronic
1164812600 19:31169754-31169776 CTCAAAGGACACATGGCCAAGGG - Intergenic
1165716264 19:38047747-38047769 CTAAAATGACACGTGGTCCGAGG - Intronic
925084668 2:1098908-1098930 CTGAAATGAAACACTGGCTATGG + Intronic
926862438 2:17322962-17322984 CTGAAATGAAAGATTGGACATGG + Intergenic
930449679 2:51519403-51519425 CTGAGATCACAGATGGGCTAAGG + Intergenic
932293951 2:70608966-70608988 CTGACAGGGCACATGGGCCATGG - Intronic
932997932 2:76880084-76880106 TTGAAATGACACAAAGGACATGG + Intronic
934473679 2:94578144-94578166 CAGAAAGGGCACAGGGGCCAGGG + Intergenic
936959433 2:118057758-118057780 CTGGAGTGAATCATGGGCCAAGG + Intergenic
937340150 2:121086122-121086144 CTGAAATGACATCAGAGCCAGGG + Intergenic
939654175 2:144802155-144802177 CAGAAATCACAGATGAGCCAAGG + Intergenic
940330504 2:152469245-152469267 CTGAAATGACACGTATGCAAAGG - Intronic
940342328 2:152594498-152594520 TTGAAATGAAACTTGAGCCAAGG - Intronic
943057645 2:183002126-183002148 ATGAAATGACTCATGGAGCAAGG - Exonic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
947794563 2:232885791-232885813 CTGCAGTGACACATGGGGCCCGG + Intronic
948294939 2:236853682-236853704 CTCAAATGACACTGGGGTCAGGG + Intergenic
1173176290 20:40767315-40767337 CTGATCTCTCACATGGGCCAGGG + Intergenic
1173362041 20:42353459-42353481 ATGATATGTCACATGGGGCATGG - Intronic
1173970512 20:47148714-47148736 CTGAAATGTCACCTGGGTCATGG + Intronic
1174230550 20:49042547-49042569 CTGAAAAGACACATTGTCTATGG - Intergenic
1174888743 20:54366027-54366049 ATGAAATAACATATGTGCCAGGG - Intergenic
1179044340 21:37831327-37831349 CTGAAATGATACATTGTACAGGG + Intronic
1181883837 22:26003139-26003161 CTGAGATCACACAGGGGCAAAGG + Intronic
1182706778 22:32287303-32287325 ATGGAATGACAAAAGGGCCAGGG + Intergenic
1182880176 22:33726321-33726343 AAGAAATGACACATGGCCCTGGG + Intronic
1184020594 22:41818706-41818728 CTGAAATGACGCATACCCCAAGG + Intronic
1184395086 22:44230381-44230403 ATGGAATGACAAAAGGGCCAGGG + Intergenic
949773500 3:7604844-7604866 CTGAAATGAGACATTTGCAAAGG - Intronic
950414893 3:12863519-12863541 CTCAAATGACATATGTCCCATGG - Intronic
950633886 3:14301873-14301895 GTGAAATGACACACAGGCAAGGG - Intergenic
951362655 3:21742774-21742796 CTGAAAAGCCACATGGGGAATGG - Intronic
951908117 3:27722992-27723014 CTGAGATGACTAATGCGCCAAGG - Intergenic
952377957 3:32782570-32782592 CTGAAATGACACCTCCTCCATGG - Intergenic
952875469 3:37941096-37941118 CTGCAGTGACACCAGGGCCAGGG + Intronic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960049778 3:113228563-113228585 CTGGAATGGCACATGGGGCCTGG - Intronic
962043283 3:131729770-131729792 CTGATCTGCCACATGGACCAGGG + Intronic
964790028 3:160445353-160445375 CTGCAATGAGCCATGAGCCACGG + Intronic
969259585 4:6025034-6025056 TTGAAATGACACAGGAACCAAGG + Intergenic
970938435 4:21602237-21602259 CTGTAATGAGACATGGAGCAAGG - Intronic
975433323 4:74320813-74320835 CTGAAATGACAGATCTGGCAAGG - Intergenic
975580491 4:75902709-75902731 CTGACAAGACACAGGGGCCTAGG + Intergenic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
977195736 4:94056545-94056567 CTGAAATAAAACATGATCCAAGG - Intergenic
983369868 4:166843635-166843657 CTGCAATCAAGCATGGGCCAGGG - Intronic
985941735 5:3141736-3141758 CTGAAAGGCAACATGGGCCTAGG + Intergenic
986573776 5:9191912-9191934 CTAAACTCACACATGGGTCATGG - Intronic
986573784 5:9191953-9191975 CTAAACTCACACATGGGTCATGG - Intronic
986573792 5:9191994-9192016 CTAAACTCACACATGGGTCATGG - Intronic
986573800 5:9192035-9192057 CTAAACTCACACATGGGTCATGG - Intronic
986573808 5:9192076-9192098 CTAAACTCACACATGGGTCATGG - Intronic
986573816 5:9192117-9192139 CTAAACTCACACATGGGTCATGG - Intronic
990219989 5:53577391-53577413 CTGAAATGACACATGGGCCAAGG + Intronic
990547817 5:56840786-56840808 CTGAAATGAGACATGAAACATGG - Intronic
990698311 5:58446966-58446988 GTCAAATCACACATGGGCCAGGG + Intergenic
993911090 5:93685689-93685711 CTGAATGGACACATGTGTCAAGG + Intronic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
996523494 5:124452481-124452503 CACAAATGACCCATGGCCCAGGG + Intergenic
997529990 5:134576239-134576261 CTGAAAGGATACAAGGGCCAGGG + Intronic
998506070 5:142673968-142673990 CTAAAATGCCACAGAGGCCAGGG - Intronic
1002765858 6:238088-238110 CTGAAACAACACATGGGGCGTGG - Intergenic
1002867889 6:1139302-1139324 ATGTAATGACACATGAGACATGG + Intergenic
1003198497 6:3936948-3936970 TCGAAATAACACATGGGTCAAGG - Intergenic
1005273120 6:24187300-24187322 CTGAAAAGAGCCCTGGGCCACGG + Intronic
1005338275 6:24819048-24819070 TTGGAATGACACATGAGACAAGG - Intronic
1006781925 6:36637776-36637798 ATGACATGACCCAGGGGCCAGGG + Intergenic
1007914536 6:45548957-45548979 CTGAGAGGACATATGGCCCACGG + Exonic
1011471453 6:87711965-87711987 CTGAGAACACACCTGGGCCATGG - Intergenic
1013639501 6:112059445-112059467 CTGAAATGGGTCATGGTCCAAGG - Intronic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1016377573 6:143438992-143439014 CTGAAAAGACACATAGACCCTGG - Intronic
1024233269 7:47378860-47378882 GTCAACTGACACATGAGCCATGG + Intronic
1025208531 7:57007780-57007802 CTGCAAGGACACATGTGTCAAGG - Intergenic
1025252125 7:57358693-57358715 CAGAAAAGGCCCATGGGCCAGGG + Intergenic
1026860329 7:73782751-73782773 TAGAAATGAAACATGGGCCTGGG - Intergenic
1027601189 7:80243569-80243591 TTGAAGTGACACCTGGCCCAAGG + Intergenic
1028724975 7:94076454-94076476 CTGAAAAGGCACAGTGGCCAGGG + Intergenic
1029048424 7:97656807-97656829 CTAAAATGACCCAGAGGCCATGG - Intergenic
1031071939 7:117171418-117171440 CTGAATTGCCACATGTGCAAGGG - Intronic
1032538642 7:132685328-132685350 CTGAAATCAGAGGTGGGCCAAGG - Intronic
1033849028 7:145471861-145471883 AAGAAATGACAGATGGTCCAGGG - Intergenic
1034834307 7:154337557-154337579 CAGAAATGACAGATGGTGCAAGG - Intronic
1035077489 7:156190514-156190536 ATGAAAAGACACCTGGGCAATGG - Intergenic
1035563815 8:628262-628284 CTGAGCTGACACAGGGGCCCTGG - Intronic
1038041771 8:23729263-23729285 CTGAAATGACTCAAGGATCATGG + Intergenic
1038926118 8:32141436-32141458 CTGAAATGAAATTTTGGCCAGGG + Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1043164056 8:76881080-76881102 CTGAAATGAAAGATAGGCCTGGG - Intergenic
1043301029 8:78732337-78732359 GTGAAATGTCATATGGGTCAAGG + Intronic
1046152047 8:110240327-110240349 CAAGAATGCCACATGGGCCAGGG - Intergenic
1046711324 8:117514971-117514993 CTGCAATTACACAAGAGCCAGGG + Intergenic
1048553623 8:135456068-135456090 CTGAAATGACACCTTAGCCGGGG + Intergenic
1052234310 9:26191619-26191641 CTCATATGACAAAAGGGCCAGGG + Intergenic
1052750890 9:32489225-32489247 CTCAAAAGACACATGGAACAAGG + Intronic
1053341716 9:37341724-37341746 CTGAGATGACATTTGAGCCAAGG + Intronic
1053684651 9:40510368-40510390 CAGAAAGGGCACAGGGGCCAGGG - Intergenic
1053934617 9:43138646-43138668 CAGAAAGGGCACAGGGGCCAGGG - Intergenic
1054279075 9:63114597-63114619 CAGAAAGGGCACAGGGGCCAGGG + Intergenic
1054297745 9:63345830-63345852 CAGAAAGGGCACAGGGGCCAGGG - Intergenic
1054395761 9:64650341-64650363 CAGAAAGGGCACAGGGGCCAGGG - Intergenic
1054430405 9:65155536-65155558 CAGAAAGGGCACAGGGGCCAGGG - Intergenic
1054499975 9:65865985-65866007 CAGAAAGGGCACAGGGGCCAGGG + Intergenic
1056147829 9:83751880-83751902 GTAAAATGACACAGGTGCCATGG + Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057401915 9:94731080-94731102 CTGAAATGACACCAGGACTAAGG + Intronic
1187026238 X:15438282-15438304 GCAAAATGACAGATGGGCCAAGG + Intronic
1187525214 X:20048011-20048033 CTGTAAAGACACCTTGGCCAAGG + Intronic
1188453889 X:30339499-30339521 CTGACATGACCCATGGTGCAAGG + Intergenic
1189203498 X:39217980-39218002 CTGAAATCAGAGATAGGCCAAGG - Intergenic
1190522410 X:51293977-51293999 CAGAAAGGAAACTTGGGCCAAGG + Intergenic
1190525642 X:51327174-51327196 TAGAAAGGACACTTGGGCCAAGG + Intergenic
1193903033 X:87206116-87206138 CTGAAAAGAAACATAGGCTATGG + Intergenic
1196437603 X:115688991-115689013 CTGCATTCACACCTGGGCCATGG + Intergenic
1199448882 X:147957688-147957710 CTGAACTAACACATGGAACATGG - Intergenic
1200167024 X:154043238-154043260 CTGGAATGACACAGAGGCGATGG + Intronic