ID: 990225766

View in Genome Browser
Species Human (GRCh38)
Location 5:53651063-53651085
Sequence CAATAGACCTTGTCTGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990225765_990225766 0 Left 990225765 5:53651040-53651062 CCGAAGTAAAAAGTTTTTTGAAG 0: 1
1: 0
2: 0
3: 62
4: 693
Right 990225766 5:53651063-53651085 CAATAGACCTTGTCTGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990225766 Original CRISPR CAATAGACCTTGTCTGCAAT TGG Intronic
912124075 1:106511150-106511172 CACATGAACTTGTCTGCAATAGG - Intergenic
913228654 1:116722288-116722310 CAATAAACTTTGTCTGGAAAGGG + Intergenic
913603146 1:120441095-120441117 CAACAGACCATGGCTGCCATGGG - Intergenic
913603894 1:120447447-120447469 CAACAGACCATGGCTGCCATGGG - Intergenic
914277719 1:146140181-146140203 CAACAGACCATGGCTGCCATGGG + Intronic
914538765 1:148591129-148591151 CAACAGACCATGGCTGCCATGGG + Intronic
914586932 1:149071300-149071322 CAACAGACCATGGCTGCCATGGG + Intronic
914587700 1:149077580-149077602 CAACAGACCATGGCTGCCATGGG + Intronic
916577559 1:166081159-166081181 CAAATGATCTTTTCTGCAATAGG - Intronic
916851948 1:168712886-168712908 CTATAGACCTTGTCTTCAGGGGG - Intronic
1062922701 10:1292097-1292119 GACTTGACCTTGTCTGCACTGGG + Intronic
1090049671 11:123366796-123366818 CATTACACCCTGTCTACAATTGG - Intergenic
1090466903 11:126943052-126943074 CAAGAGACTTTGTCTGCAGTGGG - Intronic
1091736235 12:2924349-2924371 TAATAGACCATGTCAGGAATTGG + Intronic
1093282407 12:17210729-17210751 CAAGATACCTTGTTGGCAATAGG + Intergenic
1097905276 12:64913060-64913082 AAATTGACTTTGCCTGCAATGGG - Intergenic
1098815497 12:75156496-75156518 CAATACACTTTTTCTGTAATGGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1101160821 12:101973478-101973500 CAATATTCCTTGTCTGTATTTGG + Intronic
1105771531 13:23616971-23616993 CAATCGCCCTTGTCTGCCTTAGG - Intronic
1109129724 13:58567810-58567832 CATTAGAACTTGCCTGTAATAGG - Intergenic
1110021005 13:70472285-70472307 CAATAAACCATGGCTGGAATTGG + Intergenic
1110615471 13:77536811-77536833 CAGGTGACCTTGTCAGCAATAGG - Intronic
1114876778 14:26730136-26730158 CAATAAACATTGGCTGCACTTGG + Intergenic
1115749833 14:36477962-36477984 TAATAGTTCTTGTCTGCATTTGG + Intronic
1116001583 14:39248605-39248627 CAATAGACATTATCTAAAATAGG - Intronic
1118256561 14:64210554-64210576 CAAGAGCCCCTGTCTGCACTGGG + Intronic
1118608064 14:67517518-67517540 CAATAGAGCTTCTCTGCTAAAGG - Intronic
1120627443 14:86845982-86846004 CAGGAGACCATGTCTGCAAATGG + Intergenic
1123800623 15:23816129-23816151 GACTAGACGTTGTCTGAAATGGG + Intergenic
1126057988 15:44750119-44750141 TAATAGACCTTATCTGGTATAGG + Intronic
1129649339 15:77470651-77470673 CAATAGAACTTGTCTTCATTAGG + Intronic
1144333135 17:14242625-14242647 CATCACACCTTGCCTGCAATAGG + Intergenic
1149395013 17:56231368-56231390 CCATAGACCTCCTCTGCAAAGGG - Intronic
1149645303 17:58236554-58236576 CGATAGACCTTATCTTCATTGGG + Intronic
1152237540 17:79146396-79146418 CATTAGACCGAGTCTGCAAGAGG + Intronic
1158523501 18:58191854-58191876 CCATGTACCTTGTCAGCAATGGG - Intronic
1159407441 18:68023097-68023119 AAATAGACTTTATCTGGAATGGG + Intergenic
1159572550 18:70134504-70134526 CAATAAACCTTCTTTGCCATCGG - Exonic
1162328420 19:10012064-10012086 AAATAGAGCTTTTATGCAATTGG + Intergenic
1162559757 19:11409853-11409875 CAATAAACCATGTTTTCAATGGG - Intronic
1163584533 19:18156663-18156685 CAAGGGACCCTGTCTGCAAAAGG - Intronic
1165074161 19:33271525-33271547 CAACAAACCTTTTCTGCAAAGGG + Intergenic
1168164517 19:54537536-54537558 CAACAGACATTGTCTCCCATCGG - Intronic
1168506630 19:56940736-56940758 CAATAGACCTTGTGAGCTCTAGG + Intergenic
928158473 2:28898156-28898178 TAACAGACCTTGTCTGCTATTGG + Intronic
930887732 2:56347214-56347236 CAATACACCTTGACTGAAAAGGG - Intronic
938248465 2:129796483-129796505 CAATCGACCTTCACTGCAGTGGG - Intergenic
942899568 2:181097875-181097897 CAATAGATAATGTCTGAAATGGG - Intergenic
943905850 2:193500989-193501011 CAGTAGACCTTTTCTCAAATTGG - Intergenic
945404870 2:209433252-209433274 TAATAGAGCTTGTCTGTGATGGG + Intronic
1168919260 20:1517268-1517290 CAATTGACCTGGTCTGCAGGAGG + Intergenic
1169872064 20:10258579-10258601 CATTAGACCTTGTGGGCAAAGGG - Intronic
1172373298 20:34414392-34414414 CAATAAACTCTGTCTGCCATTGG - Intronic
1174644128 20:52071019-52071041 AAATATACTTTGTGTGCAATGGG - Intronic
1180259010 21:46653883-46653905 CAATGCACTTTGTCTGCACTGGG + Intronic
1183895570 22:40965803-40965825 CAATAGACCATGTTGGCCATGGG + Intronic
949603755 3:5631820-5631842 CAAAAGACCTTGTCACCAACAGG + Intergenic
954839488 3:53497822-53497844 CTGTATACCTTGTTTGCAATAGG - Intronic
957116984 3:76038857-76038879 CAATAAATAATGTCTGCAATAGG + Intronic
963981459 3:151542974-151542996 CAATAGACGATGTCTAGAATTGG - Intergenic
966261453 3:177984063-177984085 CAACAGACCTTATCAGCAGTGGG - Intergenic
970147883 4:13056195-13056217 CCACAGACCATGTCTGCCATTGG - Intergenic
972200700 4:36711288-36711310 TAATTGAACTTCTCTGCAATTGG + Intergenic
981369765 4:143946727-143946749 AACTAGACCTTGTGTTCAATTGG - Intergenic
984623789 4:181982324-181982346 AAATAAAACTTGTCTTCAATAGG + Intergenic
985879253 5:2626236-2626258 CAATGGGGCTTGCCTGCAATAGG - Intergenic
990225766 5:53651063-53651085 CAATAGACCTTGTCTGCAATTGG + Intronic
995751240 5:115455383-115455405 TCAGAGCCCTTGTCTGCAATGGG - Intergenic
996589309 5:125128141-125128163 CAATAAACGTTTTCTGCAAAGGG - Intergenic
996881964 5:128308694-128308716 AAATAGAGCTTGTCTTCACTTGG - Intronic
1001000018 5:167996613-167996635 CAATACATCTTGTCTAAAATAGG - Intronic
1011612779 6:89169459-89169481 CAATGGACATTGTATCCAATAGG + Intergenic
1018240578 6:161770296-161770318 CAATAGGCCTTTTCTGAACTTGG + Intronic
1020654833 7:10916947-10916969 TTATAGACCATGTCTGAAATTGG - Intergenic
1022181848 7:27928410-27928432 TAAAAGGCCTTGCCTGCAATTGG - Intronic
1023304921 7:38815853-38815875 CAATAGGCCATCTCTGCAAGCGG - Intronic
1023546852 7:41326731-41326753 AAAAAGGCCATGTCTGCAATAGG + Intergenic
1025488157 7:61077634-61077656 CAATAGATTTTGTCTGCTGTAGG + Intergenic
1027972945 7:85109895-85109917 GAATAGATCTTGTAAGCAATTGG - Intronic
1039080337 8:33728004-33728026 AAATAGCCCATGTCTGCAATGGG - Intergenic
1042390726 8:68230665-68230687 AACTAGACCTGGGCTGCAATGGG + Intronic
1043238938 8:77906374-77906396 CAATTGAGCCTCTCTGCAATAGG + Intergenic
1043449008 8:80348327-80348349 CAATAGACATTCTGTGCAATTGG - Intergenic
1046833890 8:118778203-118778225 CTATATACCTTGTCTTAAATTGG - Intergenic
1052692995 9:31838982-31839004 GAATAATCCTTGTGTGCAATAGG + Intergenic
1186709022 X:12173479-12173501 CAGATGACCTTGTCTGCAGTTGG - Intronic
1186833642 X:13416318-13416340 CAGAAGACCTTGACTGCCATCGG + Intergenic
1189519879 X:41755175-41755197 CAATAGAACTTGTCAGAAATGGG - Intronic
1192609181 X:72550677-72550699 CACTAGACCTTTGCTGAAATAGG + Intronic
1194409014 X:93534013-93534035 CAATAGCCCTTGTGTGCCAAAGG + Intergenic
1195914316 X:109920939-109920961 CAGTAGTCCTTGTCTTAAATGGG - Intergenic
1197541794 X:127772318-127772340 CAATAGCATTTATCTGCAATGGG - Intergenic
1201312160 Y:12606793-12606815 CAATTGACCTTTTCTGTAAGAGG - Intergenic