ID: 990227336

View in Genome Browser
Species Human (GRCh38)
Location 5:53669387-53669409
Sequence AGTATTAACGAGGTTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990227336 Original CRISPR AGTATTAACGAGGTTGTAGA GGG (reversed) Intronic
914773482 1:150713748-150713770 AGTATAAACAAGCTTGTAGAAGG + Intronic
1064808775 10:19168660-19168682 CATATTAACTAGTTTGTAGATGG + Intronic
1071786943 10:88911779-88911801 AGTTTTAACGAAGTGGTAGAGGG + Intronic
1073793287 10:106961418-106961440 TGTATTAACTAAGTAGTAGATGG + Intronic
1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG + Intronic
1080715432 11:34795744-34795766 AGAATAAAAGAGGTTTTAGAGGG + Intergenic
1081480247 11:43479702-43479724 AGAATTGATGACGTTGTAGAGGG + Intronic
1093140077 12:15499294-15499316 AGTAATAAAGAGTTAGTAGAAGG - Intronic
1094741775 12:33297358-33297380 AGAATTAATGAGCTTGAAGACGG + Intergenic
1095701950 12:45199764-45199786 AGTATTAAAGATGCTGAAGAAGG + Intergenic
1100185875 12:92139019-92139041 TGAATTATCGAAGTTGTAGATGG - Intronic
1112874007 13:104013071-104013093 ATTATTAATGACGTTTTAGAAGG + Intergenic
1116569221 14:46494086-46494108 AGTATTAATGATGATGCAGAGGG - Intergenic
1138047676 16:53742799-53742821 AAGATTAACTAGGTTGTTGAAGG + Intronic
1147504585 17:41003053-41003075 AGTATGAACGAGGTCACAGAGGG - Intergenic
1148498984 17:48074662-48074684 TTTATTAAGGAGGTGGTAGAAGG + Intronic
1153324223 18:3801579-3801601 ATTATTAACTAGGTTATACAAGG - Intronic
930237942 2:48905618-48905640 AATATTAACAAGATGGTAGAAGG - Intergenic
1168743980 20:220320-220342 GGTCTTAAAGAGGATGTAGAGGG + Intergenic
1169797315 20:9477443-9477465 AGTATTGACCACGGTGTAGAAGG - Intronic
1171177508 20:23063843-23063865 AGTATTTAGGAAGTTGTAGAAGG + Intergenic
1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG + Intergenic
949252143 3:1998124-1998146 AGTATAAAAGACTTTGTAGATGG + Intergenic
951221164 3:20070150-20070172 TGTATTAATGAGGATGGAGAAGG - Intronic
958760461 3:98300919-98300941 AGTATTAGTGAGCTTGAAGATGG + Intergenic
959186125 3:103050055-103050077 AGATTTAAAGAGGTTGTAAAAGG + Intergenic
982107602 4:152024380-152024402 AGACTTAAGGAGGTGGTAGAGGG - Intergenic
984010910 4:174370502-174370524 AATATTTACTAGGTTGCAGAAGG + Intergenic
985620943 5:955229-955251 GGAATTAACGTGGTTGTCGAGGG - Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
993885096 5:93406849-93406871 ATTTTTATCGAGGTTGTAGCAGG - Intergenic
994959488 5:106580338-106580360 AGTATTAACTAGGGAGTAAATGG - Intergenic
997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG + Intronic
998280742 5:140804808-140804830 AGTATTAACCAGGTTTCAGTTGG - Intronic
1005130338 6:22499759-22499781 AGCATTAATGAGGTATTAGATGG + Intergenic
1010277591 6:73987936-73987958 AGTATTAATGAGGTTCCAGCTGG - Intergenic
1020736952 7:11962623-11962645 AGGTTTAAGGAAGTTGTAGAAGG - Intergenic
1024190069 7:46997106-46997128 TGGATTAATGAGGTTGTAGAAGG - Intergenic
1027750550 7:82139608-82139630 AGTGTTAACGAATTTGTACAAGG + Intronic
1028688029 7:93614698-93614720 AGTATTAATGAACTTGAAGATGG + Intronic
1043047444 8:75344512-75344534 AGTGTTAAAGAGTTTGTATATGG + Intergenic
1046613520 8:116450911-116450933 AATAATAATGAAGTTGTAGAGGG - Intergenic
1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG + Intergenic
1051156179 9:14148785-14148807 AGTATTAACGATGTAGAAGATGG + Intronic
1052725048 9:32219278-32219300 AGTATTAAAGTGTTTCTAGAAGG + Intergenic
1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG + Intergenic
1058158528 9:101542175-101542197 AGAATTAAGCAGCTTGTAGAAGG + Intronic
1187250712 X:17595522-17595544 AGTATTAACAAGATTTGAGAGGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187936382 X:24340204-24340226 AGTGTTGATGAGGTTGTGGAGGG + Intergenic
1188358728 X:29225822-29225844 AGAATTTCCTAGGTTGTAGAAGG + Intronic
1195977365 X:110542221-110542243 AGTATTAGGGAGGATGGAGAGGG - Intergenic
1199731414 X:150636716-150636738 ACTGTTAACATGGTTGTAGATGG - Intronic