ID: 990230967

View in Genome Browser
Species Human (GRCh38)
Location 5:53712578-53712600
Sequence TCCAGCTGGCCAGCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990230967_990230976 24 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230976 5:53712625-53712647 TGTGAGGTGCCATGGGAGTGAGG 0: 5
1: 44
2: 91
3: 184
4: 378
990230967_990230975 17 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230975 5:53712618-53712640 CTTAACTTGTGAGGTGCCATGGG No data
990230967_990230973 8 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230973 5:53712609-53712631 CCAGTGGGTCTTAACTTGTGAGG 0: 34
1: 97
2: 145
3: 222
4: 999
990230967_990230974 16 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230974 5:53712617-53712639 TCTTAACTTGTGAGGTGCCATGG 0: 16
1: 58
2: 96
3: 117
4: 218
990230967_990230969 -8 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230969 5:53712593-53712615 CAGCTGGAATTCCAAGCCAGTGG 0: 8
1: 25
2: 155
3: 773
4: 1053
990230967_990230970 -7 Left 990230967 5:53712578-53712600 CCTGCTGCTGCTGGCCAGCTGGA No data
Right 990230970 5:53712594-53712616 AGCTGGAATTCCAAGCCAGTGGG 0: 13
1: 115
2: 177
3: 185
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990230967 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr