ID: 990232348

View in Genome Browser
Species Human (GRCh38)
Location 5:53727191-53727213
Sequence CTTTCAGTGTTGGAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990232343_990232348 6 Left 990232343 5:53727162-53727184 CCCACACAAATCTCATGTTGAAC No data
Right 990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG No data
990232344_990232348 5 Left 990232344 5:53727163-53727185 CCACACAAATCTCATGTTGAACT No data
Right 990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG No data
990232342_990232348 7 Left 990232342 5:53727161-53727183 CCCCACACAAATCTCATGTTGAA 0: 35
1: 1338
2: 10807
3: 13100
4: 10184
Right 990232348 5:53727191-53727213 CTTTCAGTGTTGGAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990232348 Original CRISPR CTTTCAGTGTTGGAAGTGGG AGG Intergenic
No off target data available for this crispr