ID: 990242021

View in Genome Browser
Species Human (GRCh38)
Location 5:53825355-53825377
Sequence GGCTCCAGAAAGGCCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990242017_990242021 -1 Left 990242017 5:53825333-53825355 CCACATGAAGGGAAGTGCTAGAG No data
Right 990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG No data
990242015_990242021 1 Left 990242015 5:53825331-53825353 CCCCACATGAAGGGAAGTGCTAG No data
Right 990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG No data
990242016_990242021 0 Left 990242016 5:53825332-53825354 CCCACATGAAGGGAAGTGCTAGA No data
Right 990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990242021 Original CRISPR GGCTCCAGAAAGGCCCATGT GGG Intergenic
No off target data available for this crispr