ID: 990242090 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:53826028-53826050 |
Sequence | CTGTGTGATTACATTTATAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990242087_990242090 | -2 | Left | 990242087 | 5:53826007-53826029 | CCAATCACAAGAAGACAAATCCT | No data | ||
Right | 990242090 | 5:53826028-53826050 | CTGTGTGATTACATTTATATGGG | No data | ||||
990242084_990242090 | 28 | Left | 990242084 | 5:53825977-53825999 | CCTTGATGACATTATGCTAAGGG | No data | ||
Right | 990242090 | 5:53826028-53826050 | CTGTGTGATTACATTTATATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990242090 | Original CRISPR | CTGTGTGATTACATTTATAT GGG | Intergenic | ||
No off target data available for this crispr |