ID: 990242090

View in Genome Browser
Species Human (GRCh38)
Location 5:53826028-53826050
Sequence CTGTGTGATTACATTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990242087_990242090 -2 Left 990242087 5:53826007-53826029 CCAATCACAAGAAGACAAATCCT No data
Right 990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG No data
990242084_990242090 28 Left 990242084 5:53825977-53825999 CCTTGATGACATTATGCTAAGGG No data
Right 990242090 5:53826028-53826050 CTGTGTGATTACATTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990242090 Original CRISPR CTGTGTGATTACATTTATAT GGG Intergenic
No off target data available for this crispr