ID: 990243048

View in Genome Browser
Species Human (GRCh38)
Location 5:53834786-53834808
Sequence ACTTCTGGAGTTAGACATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990243045_990243048 21 Left 990243045 5:53834742-53834764 CCAGAATAGTACTTTGAAAATAA No data
Right 990243048 5:53834786-53834808 ACTTCTGGAGTTAGACATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990243048 Original CRISPR ACTTCTGGAGTTAGACATCG TGG Intergenic
No off target data available for this crispr