ID: 990243701

View in Genome Browser
Species Human (GRCh38)
Location 5:53840548-53840570
Sequence CTGAAGCTGCACAAGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990243699_990243701 19 Left 990243699 5:53840506-53840528 CCTATAAAGGTAAACCTATCAGA No data
Right 990243701 5:53840548-53840570 CTGAAGCTGCACAAGCTAGAAGG No data
990243700_990243701 5 Left 990243700 5:53840520-53840542 CCTATCAGATTAACAGCAGATTT 0: 470
1: 599
2: 2324
3: 5577
4: 3915
Right 990243701 5:53840548-53840570 CTGAAGCTGCACAAGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990243701 Original CRISPR CTGAAGCTGCACAAGCTAGA AGG Intergenic
No off target data available for this crispr