ID: 990248739

View in Genome Browser
Species Human (GRCh38)
Location 5:53891378-53891400
Sequence GAGCAGAGTCCCACGCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990248739_990248744 26 Left 990248739 5:53891378-53891400 CCTTACTGCGTGGGACTCTGCTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 990248744 5:53891427-53891449 TTCTACTGAGTTAGATGCCATGG 0: 1
1: 0
2: 0
3: 11
4: 108
990248739_990248745 27 Left 990248739 5:53891378-53891400 CCTTACTGCGTGGGACTCTGCTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 990248745 5:53891428-53891450 TCTACTGAGTTAGATGCCATGGG 0: 1
1: 0
2: 2
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990248739 Original CRISPR GAGCAGAGTCCCACGCAGTA AGG (reversed) Intronic
915923236 1:159994550-159994572 GAGCAGAGTCACAGGCAGGCAGG + Intergenic
917369162 1:174270137-174270159 GAGCAGAGTCCCAGGGGGTTAGG + Intronic
919250836 1:195054424-195054446 CAGCAGGGCCCCACGCAGTGAGG + Intergenic
1062836689 10:640454-640476 GAGCAGAGTCCGAGGCTGTCAGG - Intronic
1066056443 10:31685454-31685476 AGGCAGACTCCCACTCAGTAGGG + Intergenic
1070373833 10:75810097-75810119 GAGCAGAGTCTCTGGCAGGAAGG + Intronic
1078988143 11:16614263-16614285 GAGATGAGTCCCAGGGAGTACGG - Intronic
1081688542 11:45059360-45059382 GAGCAGCATCTCACACAGTAGGG - Intergenic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1085465759 11:76722236-76722258 GAGCTCAGTCCCCCGCAGCACGG + Intergenic
1089861192 11:121591252-121591274 CAGCAGAGTCCCAGACAGCAGGG - Intronic
1091274649 11:134342197-134342219 GAGCAGAGTCCCCCACGGGAAGG - Intronic
1105725775 13:23160540-23160562 GAGCAGAGGCCCGCGCTGTCTGG + Intergenic
1109646607 13:65265853-65265875 GAGCAGAGTCCCCAGCAGTTAGG - Intergenic
1113408905 13:110066342-110066364 GTGCTGAGTCCCACCCAGTCTGG + Intergenic
1116130828 14:40854464-40854486 GAACAGAGTCCTATGCAGAAGGG + Intergenic
1125431234 15:39595811-39595833 GAGCAGAGGCCAAAGCACTAAGG + Exonic
1125834191 15:42736288-42736310 GAGCTGAGTCTCACCCTGTAGGG + Exonic
1126734807 15:51720312-51720334 GAGCAAAGGGCCAGGCAGTAAGG + Exonic
1127534051 15:59873515-59873537 GACCACAGTGCCACACAGTATGG + Intergenic
1127782614 15:62330577-62330599 GAGCAGAGTCCCATGGGCTAGGG - Intergenic
1128704687 15:69830279-69830301 GAGCAGCGTGCCCCGCAGGAGGG - Intergenic
1133640974 16:7717058-7717080 GAGCAGAGACCCAGGAAGTAGGG + Intergenic
1142586948 17:979773-979795 GAGCAGAGCCCGGCCCAGTAGGG + Intergenic
1143270254 17:5669960-5669982 CATCAGAGTCCAAGGCAGTAGGG + Intergenic
1144098308 17:11921502-11921524 GAGATGAGTCACAAGCAGTAGGG + Intronic
1144210696 17:13012662-13012684 GAAGAGAGTACCAAGCAGTAGGG - Intronic
1148185629 17:45641588-45641610 CAGCAGATTCCAAGGCAGTAGGG - Intergenic
1148536375 17:48442475-48442497 TAGCAGAGTCCCAGGCAGGATGG - Intergenic
1153359703 18:4180284-4180306 CAGCAGAGTCCCACAAAGGAGGG + Intronic
1157713186 18:49864015-49864037 GAGCAGAGTCTCTCGCTGTGGGG - Intronic
1160010420 18:75103229-75103251 AGGCACAGTCCCAGGCAGTAGGG + Intergenic
1164783521 19:30912066-30912088 GCACAGAGGCCCACGCAGAAGGG - Intergenic
925729659 2:6909788-6909810 AAGCTGAGTCCCAGGCAGTTTGG - Intergenic
926207954 2:10847286-10847308 GGGAAGAGTGCCACCCAGTAAGG - Intergenic
927454522 2:23238058-23238080 CAACAGAGACCCAGGCAGTATGG - Intergenic
928122686 2:28594617-28594639 GAGCAGAGTCCCAGAGAGGATGG + Intronic
928698897 2:33879034-33879056 GACCAGTGTCCCAAGCAGTCAGG + Intergenic
929998949 2:46847991-46848013 GAGCAGAGTGGCAGGCAGAAGGG - Intronic
934938960 2:98486041-98486063 TGCCAGAGTCCCACACAGTAGGG + Intronic
935395538 2:102604868-102604890 AAACAGAGTCCCATGCAGTAAGG - Intergenic
940320333 2:152370202-152370224 GATCAGGGTGCCACCCAGTATGG + Intronic
947549591 2:231037144-231037166 GAGCAGAGTCCTGCACAGTTTGG - Intergenic
1169583307 20:7050338-7050360 TGGCAGAGCCCCACGTAGTAAGG + Intergenic
1177332863 21:19684115-19684137 CAGGAGGGTCCCACCCAGTAAGG + Intergenic
1178288412 21:31345268-31345290 GAGGAAAGTCCCTTGCAGTATGG - Intronic
1180895949 22:19332164-19332186 GAGCAGACTCCTGAGCAGTACGG + Intronic
1182077032 22:27501745-27501767 GAACAGAGTGCAAGGCAGTAGGG + Intergenic
1184414405 22:44343821-44343843 GGGCAGAGTCCCATGCAGACCGG - Intergenic
1185419976 22:50729755-50729777 GAGCAGAGACCCAGGCAGACAGG - Intergenic
951686435 3:25349843-25349865 GAGCAGAGTCCTACCAAGAATGG - Intronic
962615011 3:137116909-137116931 GAGCTGAGTCCCAACCTGTAGGG + Intergenic
965648298 3:170908183-170908205 GGGCTGGGTCCCCCGCAGTAGGG - Intronic
974068076 4:57098691-57098713 GATGAGAGTCCCATGCAGTGTGG - Intronic
981628621 4:146790778-146790800 GTGCAGAATCCCACTCAGCAAGG + Intronic
982159022 4:152548642-152548664 GAGTAGAGATCCATGCAGTAGGG - Intergenic
985790746 5:1925806-1925828 GAGCAGAGTCCCTGGAAGTCAGG + Intergenic
990248739 5:53891378-53891400 GAGCAGAGTCCCACGCAGTAAGG - Intronic
996412158 5:123170186-123170208 GAGGAGTGTCGCATGCAGTAAGG - Intronic
999125354 5:149242171-149242193 CAGCAGAGCCCCATGCAGGAAGG - Intronic
999280669 5:150363339-150363361 GAGCAGAGTCCATCGCAGCTGGG + Intronic
1002081175 5:176738378-176738400 GACCAGACTCCCAAGCAGTGAGG - Intergenic
1002645002 5:180648771-180648793 GAGCAGAGGCCCCCGCGGGAGGG - Intronic
1002699312 5:181111256-181111278 GAGGAGAGCCCCCTGCAGTAGGG - Intergenic
1006445708 6:34078675-34078697 GAACAGAGGGCCACGCAGTAGGG - Intronic
1026674200 7:72415744-72415766 CAGCAGGGTCCCAGGCAGTGGGG + Intronic
1029102302 7:98141856-98141878 CAGCAGAGTCCTACTCAGCAAGG - Intronic
1029991588 7:104967410-104967432 AAGCAGAGCCCCAGCCAGTAGGG + Intergenic
1033288571 7:140062579-140062601 GCGCAGAGCCCCACGCAGCCCGG + Exonic
1034415031 7:150959784-150959806 GAGCAGAAAGCCACGCAGGATGG + Intronic
1037850767 8:22325938-22325960 GAGCAGATTCCCCAGCAGTAAGG - Intronic
1038379973 8:27083796-27083818 CAGCAGATTCCCACACAGAAAGG - Intergenic
1038848747 8:31254231-31254253 GAGCAGTGTCCCAGGCATAATGG - Intergenic
1044150519 8:88770877-88770899 GAACAGAGTCCCTCTAAGTAGGG + Intergenic
1047991155 8:130288061-130288083 GAGAAGAGTTCCACGCAGCATGG - Intronic
1049494044 8:142921443-142921465 GAGCAAGGTCCCACACAGGAAGG + Intergenic
1050031621 9:1392666-1392688 GAGGAGAGACCCATCCAGTAGGG + Intergenic
1062295301 9:135822061-135822083 GAGCAGAGTCCGAGCCAGCATGG - Exonic
1062423158 9:136493753-136493775 GGGCAGAGGCCCAGGCAGTGGGG + Intergenic
1203654725 Un_KI270752v1:12332-12354 GAGCACAGTTCCAAGCACTAGGG + Intergenic
1199105350 X:143859714-143859736 GAGCACTGTCCCCAGCAGTATGG + Intergenic
1199836297 X:151595269-151595291 GAGCAGAGTCTCTCTCAGTGTGG - Intronic
1200103894 X:153701850-153701872 GTGAAGGGTCCCACTCAGTAGGG + Intronic