ID: 990252473

View in Genome Browser
Species Human (GRCh38)
Location 5:53930332-53930354
Sequence CTCAGGTGACCAAGAAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990252473_990252477 -8 Left 990252473 5:53930332-53930354 CCAACATTTCTTGGTCACCTGAG 0: 1
1: 0
2: 3
3: 12
4: 168
Right 990252477 5:53930347-53930369 CACCTGAGAGGGTATCATCAGGG No data
990252473_990252476 -9 Left 990252473 5:53930332-53930354 CCAACATTTCTTGGTCACCTGAG 0: 1
1: 0
2: 3
3: 12
4: 168
Right 990252476 5:53930346-53930368 TCACCTGAGAGGGTATCATCAGG 0: 1
1: 0
2: 0
3: 5
4: 72
990252473_990252479 6 Left 990252473 5:53930332-53930354 CCAACATTTCTTGGTCACCTGAG 0: 1
1: 0
2: 3
3: 12
4: 168
Right 990252479 5:53930361-53930383 TCATCAGGGCAGCTTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990252473 Original CRISPR CTCAGGTGACCAAGAAATGT TGG (reversed) Intronic
900760775 1:4468697-4468719 CTCAGGAGACCAAGTCATGATGG - Intergenic
902291192 1:15436333-15436355 CTCAGGAGACTAAGTAAGGTAGG + Intergenic
902715962 1:18272862-18272884 CTCAGATGACAGAGATATGTGGG + Intronic
903441979 1:23394965-23394987 CTCAGGAGACCAAGAAAATGAGG - Intronic
908110682 1:60894436-60894458 CTCAGATGACAAAGAAAGATGGG + Intronic
908973499 1:69866902-69866924 CTTAGTTGATTAAGAAATGTTGG - Intronic
909506258 1:76393544-76393566 CTCAGGTGAAAAAGAAATGAAGG + Intronic
910215098 1:84835821-84835843 TTCTGTTGACCAAGAAGTGTGGG - Intronic
911416576 1:97582297-97582319 CTCAGGTAAACAAGAAGTGCAGG - Intronic
912129827 1:106587418-106587440 AACTGGTGACAAAGAAATGTAGG - Intergenic
913698339 1:121349549-121349571 CTCTGGTGACCACCAAATGGAGG - Intronic
913998710 1:143674088-143674110 CTGTGGTGACCAAGTCATGTGGG - Intergenic
914139213 1:144930493-144930515 CTCTGGTGACCACCAAATGGAGG + Intronic
915645151 1:157265257-157265279 ACCATGTGACCCAGAAATGTTGG - Intergenic
917624180 1:176829407-176829429 CTCAGGGAGCCAAGAAATGCTGG + Intronic
920021660 1:202961101-202961123 ATTAGCTGATCAAGAAATGTTGG + Intergenic
920485738 1:206368205-206368227 CTCTGGTGACCACCAAATGGAGG - Intronic
1063543529 10:6958095-6958117 ATCAGGTGACCAGGATATCTGGG - Intergenic
1064274114 10:13891378-13891400 CTGAGGTGCCCAAGGAAAGTAGG + Intronic
1064921313 10:20522054-20522076 CTCAGGTGCCCATCAATTGTGGG - Intergenic
1065862157 10:29881052-29881074 CTCAGGCCACTAAGAGATGTAGG - Intergenic
1070432522 10:76355373-76355395 ATCAGGTTACCAAGAAATTATGG + Intronic
1070833397 10:79433681-79433703 CACAGGTGCCCAAGAACTGCAGG + Intronic
1072659483 10:97354884-97354906 GGCAGGTGACCTAGAAAGGTTGG - Intergenic
1073493608 10:103872081-103872103 CCCAGGTAACCAGGAAATATGGG - Intergenic
1074773993 10:116753068-116753090 CTCAGCTGGCCAAGGGATGTTGG + Intergenic
1077747382 11:4922007-4922029 CACTGGTGACTCAGAAATGTAGG - Intronic
1080984610 11:37446285-37446307 CTCAGGCTAACAAGAAATGTGGG - Intergenic
1084985987 11:72872241-72872263 CTCAGGTGACAAAGACCTTTTGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1091040620 11:132277378-132277400 ACCAGGTGACCAAGGATTGTAGG + Intronic
1092141738 12:6188606-6188628 CTCAGGTGCTCAGTAAATGTGGG + Intergenic
1092219328 12:6701853-6701875 CTCGGGTGACCTCTAAATGTTGG + Intergenic
1092922463 12:13244903-13244925 CATTGGTGACAAAGAAATGTGGG - Intergenic
1095384515 12:41634821-41634843 CTCATAGGACCAAGAAATCTGGG + Intergenic
1097308853 12:58097069-58097091 CTCTGGTCACCAAAATATGTAGG + Intergenic
1098071590 12:66681527-66681549 ATCTGGTAGCCAAGAAATGTAGG - Intronic
1098895541 12:76056361-76056383 CTAAGGTGACCAAGATGTGTAGG + Intronic
1098987582 12:77029076-77029098 CTTAGGTAACCAAGACATCTTGG - Intronic
1106152483 13:27119097-27119119 AGCAGGTGTCCAATAAATGTTGG + Intronic
1110921407 13:81091253-81091275 CACAGGTGACCAATATTTGTTGG - Intergenic
1111381553 13:87460021-87460043 CTTAAGTGAACAAGAAATATAGG - Intergenic
1111690280 13:91555481-91555503 CTCTGGTGGCCAAGAAATGGTGG - Intronic
1112336960 13:98523990-98524012 CTCAGCTCAACAAGAATTGTGGG - Intronic
1114397948 14:22383946-22383968 CTCAGGGGACCCTGAGATGTTGG - Intergenic
1115192409 14:30759830-30759852 CTAAGGTGACCCAGATCTGTTGG - Intergenic
1115321290 14:32082039-32082061 CTCAGAGGATCAAGAACTGTAGG - Intronic
1117688470 14:58280142-58280164 CTCAGGTGACCAACCCATCTTGG - Intronic
1118037485 14:61883591-61883613 CTCAGATGACAGAAAAATGTAGG - Intergenic
1118328091 14:64795098-64795120 CCCTGGTGACCGAGAAATCTTGG - Intronic
1118694802 14:68373983-68374005 ATAAGGTGCCCAATAAATGTCGG - Intronic
1122193740 14:100068804-100068826 CACAGGTTCCCAGGAAATGTGGG + Intronic
1122261039 14:100523241-100523263 CAAGGGTGACCCAGAAATGTGGG + Intronic
1124219515 15:27837368-27837390 CACAGATCAACAAGAAATGTAGG + Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1129670216 15:77603688-77603710 AGCAAGTGACCAATAAATGTTGG - Intergenic
1134041047 16:11068536-11068558 TTGTGGTAACCAAGAAATGTTGG - Intronic
1137249314 16:46730742-46730764 CACAGGTGACCGAGAGGTGTGGG - Intronic
1137309870 16:47244466-47244488 CTCTGGTCACCAAAATATGTAGG - Intronic
1137463001 16:48682796-48682818 CTTAGGTGACCAAACAAGGTGGG + Intergenic
1138452057 16:57099031-57099053 TTCTGGTGACCCAGATATGTTGG - Intronic
1138865655 16:60816074-60816096 CCCATGTGACAAAGAACTGTTGG - Intergenic
1138943370 16:61817354-61817376 CTCACATGACCAAATAATGTTGG - Intronic
1139126142 16:64080056-64080078 ATCCAGTGCCCAAGAAATGTGGG + Intergenic
1142619984 17:1159153-1159175 CTCAGGAGTCCAAGAGAAGTAGG + Intronic
1142977629 17:3655322-3655344 CTCAGGTGATCATGAATTGGAGG + Exonic
1146442700 17:32910894-32910916 CTAAGGTGGTCAAGAAATGGAGG + Intergenic
1148443667 17:47725184-47725206 TTCAGATGGGCAAGAAATGTAGG + Intergenic
1149441120 17:56674780-56674802 CTCAGGTGACAAAGAAAAAGTGG + Intergenic
1154059517 18:11046652-11046674 CTCAGGAGAACAAGAGATGGAGG - Intronic
1156498471 18:37541573-37541595 CTAAGGTTAGCAAGAAGTGTTGG - Intronic
1158291596 18:55950845-55950867 GTCAGGGAACCAAGAAATGTAGG - Intergenic
1160313720 18:77821202-77821224 CTCATGGAACCAAGAAAAGTGGG - Intergenic
1161350539 19:3788922-3788944 CTCAGGTGATCTACCAATGTTGG + Intronic
1161656172 19:5516522-5516544 CTCTGGTGACCTTGAGATGTCGG - Intergenic
1163610563 19:18299262-18299284 CTCAGGTGATCGAGAAACGCTGG + Intergenic
1167360953 19:49030103-49030125 AGCAGGTGACAAAGAAGTGTTGG - Intronic
1167363438 19:49042495-49042517 AGCAGGTGACAAAGAAGTGTTGG - Intergenic
926338238 2:11880917-11880939 CTCAGGTGACCAAGATGGCTGGG - Intergenic
929311497 2:40431309-40431331 TTCAAGTGACCAAAAAATGCAGG + Intronic
929378322 2:41317985-41318007 CTCAGGTAAGCCATAAATGTTGG + Intergenic
929836977 2:45411237-45411259 CTCTGGTCACCAAAATATGTAGG - Intronic
930340422 2:50106534-50106556 GACAGGTGACTAAGAGATGTGGG + Intronic
930910556 2:56624259-56624281 CTCTGGTGACTAAGTAATGGAGG - Intergenic
931250861 2:60529548-60529570 CTCAGGTTACAAAGACATCTAGG + Intronic
932592004 2:73073181-73073203 CTTAGGTGCGCAATAAATGTGGG + Intronic
933622471 2:84558832-84558854 ATTAGGTTACCCAGAAATGTAGG - Intronic
934232365 2:90195930-90195952 TTCAATTGACCAAAAAATGTAGG - Intergenic
937272798 2:120664283-120664305 TTCAGGTGATCTAGAATTGTGGG + Intergenic
943131778 2:183862763-183862785 GCCAGGTTACCAATAAATGTTGG + Intergenic
943311759 2:186334236-186334258 CTCTGGTCACCAAGAAGTGTGGG - Intergenic
943709271 2:191072119-191072141 CTCGGGGGTCCAAAAAATGTTGG + Intronic
944128854 2:196324236-196324258 CTCAGATCTCCAAGAAATGGAGG + Intronic
946072219 2:217044120-217044142 CCCAGCTGACCACCAAATGTAGG + Intergenic
1168794346 20:601449-601471 CTCAGGTGACCCACCCATGTTGG - Intergenic
1169166750 20:3430684-3430706 GTCACCTTACCAAGAAATGTCGG + Intergenic
1171284012 20:23923180-23923202 CACAGGTGACCATGGGATGTTGG - Intergenic
1172558620 20:35865973-35865995 CTCAGGTGACCCACCCATGTTGG - Intronic
1173523876 20:43717560-43717582 CTTGGGTGACCAAGGACTGTAGG - Intergenic
1174035490 20:47666006-47666028 CCCAGGTGCCCAAGAGGTGTGGG + Intronic
1174035531 20:47666177-47666199 CTCAGGGGCCCAAGAGGTGTGGG + Intronic
1174167818 20:48597855-48597877 CCCAGGTGACCCTGAAATGAAGG + Intergenic
1178469680 21:32881285-32881307 CTCAGTGGAACAAGAAAGGTAGG - Intergenic
1179681050 21:43021697-43021719 GTCAGGTGAGCCAGAAAAGTGGG + Intronic
1180111542 21:45657446-45657468 CTCAGTTGACCATAAAATATGGG + Intronic
1183457858 22:37932526-37932548 GTCAGGTGACCAGGCACTGTTGG + Intronic
950422042 3:12904988-12905010 CTCAGGTCAGCAAGAGATGCAGG + Intronic
951164123 3:19464232-19464254 ATCAGGTGACCATAAAGTGTGGG - Intronic
952540546 3:34363153-34363175 GGCAGGTGGCCATGAAATGTAGG - Intergenic
952946906 3:38484059-38484081 CTCAGGTAACCAGGAATTGAGGG + Exonic
953830156 3:46290121-46290143 CTCAGATGGCTAAGAAATGACGG + Intergenic
954613618 3:51958725-51958747 CTCATGTGCCCAAGAAAGGCAGG - Intronic
956234765 3:67057133-67057155 CTCAGATTAACAAAAAATGTAGG - Intergenic
960029280 3:113041477-113041499 CTAAAGTGCCCAAGAAATGTGGG - Intergenic
962840417 3:139227410-139227432 CCCAGGTGACAAAGCAGTGTGGG - Intronic
963805516 3:149717626-149717648 CTCTGGTGCCCAAGAAGTGAAGG + Intronic
964032788 3:152157225-152157247 CTTAGGAGACCAAGCAACGTAGG - Intergenic
964247548 3:154670712-154670734 CTCAGGTGACCTAAAGATTTAGG - Intergenic
968414553 4:418912-418934 GTCAGGTGATCCAGAAATCTAGG - Intergenic
969073292 4:4557126-4557148 TTCAGTGGACCAAGAAATGGAGG - Intergenic
971124091 4:23733485-23733507 ATCAGCTGATCAAGAAAGGTAGG - Intergenic
973902852 4:55495437-55495459 CTCAGATGACCAAGCCCTGTTGG + Intronic
974438929 4:61892608-61892630 CTCCTGTGAACAAGCAATGTAGG + Intronic
975536280 4:75454522-75454544 CTCAAGTGACCATCAAATGGTGG + Intergenic
980709486 4:136545765-136545787 CTTATGTGAGGAAGAAATGTTGG + Intergenic
980818164 4:137975980-137976002 CTCAGGTGATCCACACATGTAGG + Intergenic
983322138 4:166209272-166209294 ATCAGGTGGCCAAGAAATATAGG - Intergenic
983329053 4:166301145-166301167 TGCAGGTTACCAAGAAATATAGG - Intergenic
986563230 5:9084826-9084848 CTCAGAAGACAAAAAAATGTGGG + Intronic
988182051 5:27808289-27808311 CTCAGATCACCAAGGTATGTAGG - Intergenic
990252473 5:53930332-53930354 CTCAGGTGACCAAGAAATGTTGG - Intronic
993884696 5:93401899-93401921 CTCAAGTGACCCAGAAATGCAGG - Intergenic
994865218 5:105259997-105260019 CTCAGGTGACAAAGCAACCTCGG - Intergenic
1000601962 5:163285693-163285715 CACAGGTGGCCAAGAAATGGTGG + Intergenic
1003414658 6:5897183-5897205 TTCAGGTGTCCGAGAAATGCAGG - Intergenic
1004551955 6:16656415-16656437 CCAAGGTGACCAAGATAGGTGGG + Intronic
1008912031 6:56744796-56744818 CTCCAGTCACCAAGTAATGTTGG - Intronic
1009851839 6:69208344-69208366 CACTGGTGACAAAGAAATTTGGG - Intronic
1013115855 6:107103271-107103293 GGCAGGTGACCAGGAAATGGAGG - Intronic
1013412986 6:109898127-109898149 ATGAGGTGACACAGAAATGTGGG + Intergenic
1013602230 6:111715619-111715641 CCCATGTGACCAAGAACTGAGGG + Intronic
1013922363 6:115422242-115422264 ATCAGGTGATCAAGAGATGCAGG - Intergenic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1019233852 6:170592434-170592456 CACAGGTCAACAATAAATGTTGG + Intergenic
1021459915 7:20874868-20874890 CTCTGGAGCCCAAGAAATCTGGG - Intergenic
1022422705 7:30238984-30239006 CTTATTTGCCCAAGAAATGTAGG + Intergenic
1024485033 7:49908272-49908294 CTCAGGTCATGATGAAATGTAGG - Intronic
1026635648 7:72079620-72079642 CCATGGTGACCCAGAAATGTAGG - Intronic
1031176574 7:118359815-118359837 CTCAGGTGCTCAATAAATGTTGG - Intergenic
1032800898 7:135316613-135316635 CTCAGGGAAGCCAGAAATGTAGG + Intergenic
1033028354 7:137800088-137800110 CTCAGGTACCCAAGAGATTTGGG + Intronic
1033241257 7:139681849-139681871 GTCAGTGGACAAAGAAATGTAGG - Intronic
1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG + Intergenic
1038422193 8:27440437-27440459 CTCAGGTGAGCATGGAGTGTGGG + Exonic
1038672508 8:29593613-29593635 CCTAGGAGACCAGGAAATGTAGG - Intergenic
1039005081 8:33027121-33027143 GTCAGGTGACCATCAAATGATGG - Intergenic
1039609045 8:38904368-38904390 CTCAGCTGACCAGGCACTGTGGG - Intronic
1039919440 8:41882933-41882955 CTCAGGTGAACAGGGAATGCAGG - Intronic
1041377397 8:57217620-57217642 CTCAGGTGACCAGGAGGTGATGG - Intergenic
1042026170 8:64426161-64426183 CTTAGGTGATTAACAAATGTTGG - Intergenic
1048138419 8:131769201-131769223 CTCTGGTGACAAAGAATTCTGGG - Intergenic
1051691693 9:19720147-19720169 CTAATATGATCAAGAAATGTAGG + Intronic
1051696685 9:19775310-19775332 ATCAGGTGGAAAAGAAATGTGGG - Intronic
1052036344 9:23685349-23685371 CTCAGGTTAGCAAAAAATCTTGG + Intergenic
1053579595 9:39390824-39390846 CTCAGGTGTGAAAGAAAGGTAGG + Intergenic
1054101182 9:60949633-60949655 CTCAGGTGTGAAAGAAAGGTAGG + Intergenic
1054122556 9:61224996-61225018 CTCAGGTGTGAAAGAAAGGTAGG + Intergenic
1054585171 9:66957247-66957269 CTCAGGTGTGAAAGAAAGGTAGG - Intergenic
1054944317 9:70779063-70779085 CTCAGCTAATCAAGTAATGTAGG + Intronic
1055069037 9:72148001-72148023 CTAAGGTGACCAACAAATCCTGG - Intronic
1058793363 9:108472970-108472992 CTCAGGAAATCAAGAGATGTGGG + Intergenic
1059057998 9:111004679-111004701 CTCTGATGACTAGGAAATGTTGG + Intronic
1060355067 9:122898887-122898909 CTCTGGTGAACAAGAAATCTAGG + Intronic
1060422088 9:123476500-123476522 ATCAGGTGACCAACAAATGTTGG - Intronic
1061110197 9:128563945-128563967 CAGAGGTCATCAAGAAATGTTGG - Intronic
1061806414 9:133139908-133139930 CTCAGGGGACCCAGACAAGTGGG - Intronic
1061888976 9:133607786-133607808 CTCGGGGGCCCAGGAAATGTGGG - Intergenic
1187038788 X:15570813-15570835 CCCAGGAGAACAACAAATGTTGG + Intronic
1189697702 X:43682179-43682201 CTCAGCTCACAAAGAAATATAGG - Intronic
1192772207 X:74204610-74204632 CTCAGGTTAGCAAAAAATGCGGG + Intergenic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1195105080 X:101595865-101595887 CTCAGGTGACCAAGATCTGTGGG + Intergenic
1198483422 X:137062290-137062312 CTCAGTTCACCAAGATGTGTGGG + Intergenic
1200289432 X:154857709-154857731 AACAGGTGACAAAGAAATTTGGG + Intronic