ID: 990254636

View in Genome Browser
Species Human (GRCh38)
Location 5:53954288-53954310
Sequence AGGTATTTGCAGATGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 467}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990254636_990254639 -9 Left 990254636 5:53954288-53954310 CCATCCATCATCTGCAAATACCT 0: 1
1: 0
2: 1
3: 33
4: 467
Right 990254639 5:53954302-53954324 CAAATACCTTCCTCTGTCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 227
990254636_990254642 11 Left 990254636 5:53954288-53954310 CCATCCATCATCTGCAAATACCT 0: 1
1: 0
2: 1
3: 33
4: 467
Right 990254642 5:53954322-53954344 GGGATCCAAGCCCTCTGCCAAGG 0: 1
1: 0
2: 2
3: 18
4: 170
990254636_990254638 -10 Left 990254636 5:53954288-53954310 CCATCCATCATCTGCAAATACCT 0: 1
1: 0
2: 1
3: 33
4: 467
Right 990254638 5:53954301-53954323 GCAAATACCTTCCTCTGTCTTGG 0: 1
1: 1
2: 2
3: 28
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990254636 Original CRISPR AGGTATTTGCAGATGATGGA TGG (reversed) Intronic
900691009 1:3980606-3980628 AAGGATGGGCAGATGATGGATGG - Intergenic
901428741 1:9199595-9199617 AGGGATGGGCAGGTGATGGAGGG - Intergenic
901444625 1:9300522-9300544 AGTTATTTGTGGATGATGGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906233423 1:44185704-44185726 AGGAATTTGAAAATAATGGATGG + Intergenic
906791939 1:48666566-48666588 AGGAAATAGCAGATGATAGAGGG - Intronic
907414448 1:54304518-54304540 AGGGAGTTGCAGGTGATGGTGGG + Intronic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907851999 1:58264002-58264024 ATGTACTTGCAGATTTTGGAAGG + Intronic
908266806 1:62387262-62387284 AGGTTCTCGCCGATGATGGAGGG + Intergenic
908386228 1:63644223-63644245 AGGTGTTTGAAGATGCTGAAAGG + Intronic
909258486 1:73455436-73455458 AGGTATTTGCAGATTTTAAAAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910625050 1:89297632-89297654 CTGTATCTGCACATGATGGAAGG - Intergenic
910710425 1:90174123-90174145 TGGTATTTGAAGATGAGGCATGG + Intergenic
911016464 1:93338353-93338375 AGGTACATCCAGCTGATGGAAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913302582 1:117387966-117387988 GGGTATTTGGAGATGACGGCGGG - Intronic
914255526 1:145959157-145959179 ATATATCTGCTGATGATGGAGGG + Intergenic
914988224 1:152477705-152477727 AGGAATTTGCACCTGATGCAGGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916925455 1:169515149-169515171 GGGAACTTGCTGATGATGGAAGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
921686984 1:218101201-218101223 TGGTGTATGCAGGTGATGGAAGG + Intergenic
922215553 1:223516747-223516769 AGGGATTTGCAGGGAATGGAAGG - Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
923033918 1:230271034-230271056 AGGTGTTGGCGGATGCTGGATGG - Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924625856 1:245695986-245696008 GGGTATTGGCAGGAGATGGAGGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063630374 10:7728143-7728165 AGGTATGTGAAGATGGTGTATGG + Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065287581 10:24200924-24200946 AGGTATGTGCAGATGAGAGGTGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068551491 10:58412931-58412953 AGGTATTTGCAAATAAGGCAAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070264684 10:74890946-74890968 GGTTATTTGCAAATGCTGGAAGG - Intronic
1071055966 10:81508060-81508082 AGGTATTTGGAAATGATATAGGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072271903 10:93784758-93784780 AGATCTTTGCAGAGGAAGGAGGG + Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075704790 10:124494248-124494270 AGGTTTTGCCAGATGATGGGAGG + Intronic
1075767459 10:124905020-124905042 TGTTATTTCCAAATGATGGAAGG - Intergenic
1076464621 10:130670420-130670442 TGGTATTTGAAGATGAGGCAGGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077650162 11:3964229-3964251 AGGTATTTCCAGATGGTTGTGGG + Intronic
1077845868 11:6024263-6024285 AGGGATTTGTAAAGGATGGAGGG - Intergenic
1077934572 11:6770016-6770038 AAGTAGGTGCAGATTATGGAAGG - Intergenic
1078552889 11:12292622-12292644 AGGAATTTGCAGCTGTAGGATGG + Intronic
1078752858 11:14181409-14181431 AGGTAGTTGGAGAAAATGGATGG - Intronic
1080266177 11:30404342-30404364 AAGCATTTGGAGGTGATGGATGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1084020230 11:66412898-66412920 TGGCATTTGCAGATGTTTGAAGG - Intergenic
1084714629 11:70865901-70865923 AGGTATTTGAAGTTGAGGAAGGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089125423 11:116173117-116173139 TGGTGTTTGCAGTTGATGAATGG + Intergenic
1089562714 11:119352937-119352959 AGTAATTTGCAGATGAGGCACGG + Intergenic
1090216876 11:124975166-124975188 CAGTGTTTCCAGATGATGGAAGG + Exonic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090295661 11:125585512-125585534 AGGTTTATGCGGTTGATGGAAGG + Intergenic
1090312202 11:125750950-125750972 AGGTATGTACAGATGTTGAAAGG - Intergenic
1091418952 12:317924-317946 AGGTATTTCCTGATGATCCAGGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093007409 12:14065093-14065115 AGGGATTTGCAGACCAAGGAGGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093766273 12:22966885-22966907 AGGTAGGTGCAGGTGATGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095887266 12:47202187-47202209 AGTTATTTGCACATAATAGAAGG + Intronic
1095984791 12:47992197-47992219 GGGGATTGGCAGCTGATGGAGGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096466560 12:51849928-51849950 AGGGCTGTGCTGATGATGGAGGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098889326 12:75992805-75992827 AATTATATGCACATGATGGAAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099765836 12:86982447-86982469 AAGCCATTGCAGATGATGGAAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1108556643 13:51600014-51600036 AGCTATCTGGAGATGAGGGAGGG - Intronic
1108623326 13:52204830-52204852 ATGTAGATGCAGCTGATGGAGGG - Intergenic
1108663399 13:52606207-52606229 ATGTAGATGCAGCTGATGGAGGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109325407 13:60861352-60861374 AGATATTTGGGGATGAAGGATGG - Intergenic
1110046944 13:70842837-70842859 AGGTCTCTGCAGAGGATTGAAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112126456 13:96473666-96473688 TGGCTTTTGCAGATGATGGATGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112752973 13:102600293-102600315 AGGAGTTTACAGATGACGGATGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116372252 14:44150922-44150944 ATGTATTTGAAGATGACAGAAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1118978521 14:70697997-70698019 AGGGATTTGGAGATGAGGAATGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120315521 14:82887596-82887618 AGGTATTTGAAGCTCATGGCTGG + Intergenic
1125113265 15:36058738-36058760 TGGTAATTGCATATGATGAATGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127644903 15:60948172-60948194 AGTTCTTTCCAGAGGATGGATGG + Intronic
1128929466 15:71691104-71691126 CGGGCTTTGCAGATGAAGGAAGG + Intronic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1130251622 15:82303815-82303837 AGGCATTGGGAGATGTTGGAGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132175448 15:99710594-99710616 AGGGCTCTGCATATGATGGAAGG - Intronic
1132667013 16:1085952-1085974 AGGTGTCTGCTGATGATGAATGG - Intergenic
1134684178 16:16147162-16147184 AAGTATCTGTGGATGATGGATGG + Intergenic
1135061641 16:19276033-19276055 AGTTATCTGCGGATGATGCACGG + Intergenic
1135525044 16:23207754-23207776 AGGTACTTGCAGCTAATTGAGGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138220238 16:55244075-55244097 TGGTATTTGCAGGTGGTGTAAGG + Intergenic
1138515667 16:57534457-57534479 AGGAGTTTGCTGATGAAGGAAGG - Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1140650969 16:77087980-77088002 AGGGGTTGGCAGGTGATGGAGGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141922817 16:87147272-87147294 AGGTAGTTGCAGATGAGGGGTGG + Intronic
1145304884 17:21668410-21668432 AAGTATTTGTAGATGAATGAAGG - Intergenic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146411800 17:32592270-32592292 AGGGGTTTGGAGATGAGGGAGGG - Intronic
1146840162 17:36146487-36146509 TTGTATTAGGAGATGATGGAGGG - Intergenic
1149249424 17:54750818-54750840 AGGTATTCTCACATGATGGAAGG - Intergenic
1150388513 17:64778211-64778233 TGGAAATTGCAGATGAGGGATGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152473792 17:80504400-80504422 AGGGATGGGCGGATGATGGATGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153521281 18:5956377-5956399 ATGTATTTGCAGCAGATCGATGG - Exonic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1154974009 18:21439258-21439280 AAGTCTTTGGAGATGATGGGTGG - Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156021936 18:32609414-32609436 AAATATTTGAAGATGATGAAAGG + Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157095477 18:44682279-44682301 AGGTATTTGGAGAGGAAGGGCGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159251209 18:65879405-65879427 AGGTATTTGTAGATGAATAAAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161377464 19:3947315-3947337 AGGAAGTTGGAGGTGATGGAGGG - Intergenic
1162850726 19:13429380-13429402 AGGTATTTTGAGATCTTGGAGGG + Intronic
1163252080 19:16131922-16131944 ACGGACTGGCAGATGATGGATGG + Intronic
1164486227 19:28657934-28657956 AGGTCTTTGCAGGGGATGGGAGG - Intergenic
1165381651 19:35485906-35485928 AGATCTTTGCAGTGGATGGATGG + Intergenic
1167384234 19:49154851-49154873 AGGTCTTTGCAGAGCATGGTGGG - Exonic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925631442 2:5897703-5897725 AAGTATTTGCAGCTGATGGCAGG + Intergenic
925773911 2:7313078-7313100 CGGTAATTGCAGATGTTGTATGG - Intergenic
928095403 2:28401743-28401765 AGGTGTGTGCATATGAAGGAGGG - Intronic
928521758 2:32095883-32095905 AGGTATAGGCAGATCATGGATGG + Intronic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
930738931 2:54809465-54809487 AGGTCTTTGCATATAATTGAGGG - Intronic
931798795 2:65737974-65737996 AGGTATAAGCAAAGGATGGAGGG - Intergenic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935401220 2:102662542-102662564 GGGTATTTGCAAAGGCTGGAGGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937791275 2:125964933-125964955 AGGGAAATGCAGATGAAGGAGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939731770 2:145793491-145793513 AGGTTTTTGCAGAGACTGGAGGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940341174 2:152583265-152583287 AGGCATTTGCATCTGATAGAAGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942079702 2:172388406-172388428 ACGTCTTTGGAGATGATAGAAGG + Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944915536 2:204357102-204357124 AAGTATTTTCACATGATTGAAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947012729 2:225583361-225583383 AGGTATGTGCAGATAACGCACGG + Intronic
947151266 2:227118450-227118472 AGGACTTTGTGGATGATGGAAGG - Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1171522391 20:25785850-25785872 AAGTATTTGTAGATGAATGAAGG - Intronic
1171530140 20:25847795-25847817 AAGTATTTGTAGATGAATGAAGG - Intronic
1171554436 20:26070033-26070055 AAGTATTTGTAGATGAATGAAGG + Intergenic
1172503983 20:35447460-35447482 AGGTATTTGCAGCCCAGGGAAGG - Intronic
1175677398 20:60958540-60958562 AAGTATTTCCAGGAGATGGAAGG + Intergenic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1176656196 21:9590848-9590870 AAGTATTTGTAGATGAATGAAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178220013 21:30645419-30645441 AGGTGTTTGCAAATCAGGGAAGG + Intergenic
1178630535 21:34256519-34256541 AGCTATTTTCAGTTGATGAAAGG + Intergenic
1178784050 21:35635841-35635863 AGGGATTGCCAGAAGATGGAGGG + Intronic
1179053276 21:37907714-37907736 TGATATTTGAAGATGAAGGAAGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1184826777 22:46957891-46957913 ATCCATTTGCAGATGATGGAGGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950375508 3:12568945-12568967 TAGTACTTGCAGATGGTGGACGG - Exonic
950439449 3:13000645-13000667 AGGTATATGCAGCAGAGGGAAGG + Intronic
950950322 3:16992040-16992062 TTGAATTTTCAGATGATGGAGGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952033304 3:29170679-29170701 AGGGATTTTCAGATGAGGGGAGG + Intergenic
952418205 3:33108495-33108517 AGGTATAAGCACATGAAGGAAGG + Intergenic
953260696 3:41336336-41336358 ACGTATCTGAAAATGATGGAGGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957138642 3:76323515-76323537 AGGTATTTGGAGAATATTGATGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958410744 3:93812513-93812535 CGGTATTTGAAAATCATGGAAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962587775 3:136860118-136860140 AGGTATTTTCAGTTTATGGTGGG + Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965930385 3:174035655-174035677 AGGTGTTTGCAAATGATAAATGG - Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG + Intergenic
968598395 4:1497092-1497114 ATGGATGTGTAGATGATGGATGG + Intergenic
968598421 4:1497265-1497287 ATGGATGTGTAGATGATGGATGG + Intergenic
968598451 4:1497471-1497493 ATGGATGTGTAGATGATGGATGG + Intergenic
970542146 4:17090874-17090896 AGGTATTTGCAGAAGGTCCATGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972620406 4:40743140-40743162 AGGTATTGGAAGGTGAAGGATGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974452249 4:62080493-62080515 AGGTATTTGCAGATATTTGCAGG - Intergenic
974986838 4:69037917-69037939 AGCTTTTTGCATATGATGGTTGG + Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975229395 4:71913681-71913703 AGGAATTTGGAGAGGATGAAAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
979927542 4:126586275-126586297 ATGTATTTGCATATTATTGAGGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981952080 4:150422280-150422302 ATGGCTTTGCAGATGATGGGGGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982664179 4:158241193-158241215 TGGTATTTGCAGATAATGTTCGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983335119 4:166381592-166381614 AGGTCTTTGCTGATGATGAGAGG + Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983965307 4:173802221-173802243 AGCCATTTGCAGATAATTGAAGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984746018 4:183218821-183218843 AGGTATATTCACATTATGGAGGG + Intronic
986433841 5:7708758-7708780 AGGGACTGGGAGATGATGGACGG + Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989182390 5:38591581-38591603 AGGTTTGTGCAGATGTTTGAAGG + Intronic
989214116 5:38885890-38885912 TGGTATTTGTTGGTGATGGATGG + Intronic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992210899 5:74478575-74478597 TGTTATTTGCAAATGATGTATGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992972129 5:82072090-82072112 ACTTCTTTGCAGTTGATGGATGG + Intronic
993011034 5:82483269-82483291 TGGTATTTGGAGGAGATGGAAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993956510 5:94241081-94241103 TGGACTTTGCAGATGCTGGATGG - Intronic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996352289 5:122557936-122557958 AGGTATTAGCTAATAATGGATGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999381661 5:151125721-151125743 AGATCTTTGCAGATGATTGTAGG - Intronic
999940538 5:156537777-156537799 AGGTCTTGACACATGATGGAAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000621897 5:163495366-163495388 AGGTGTTGGAAAATGATGGAAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002826903 6:782203-782225 AGGTGTTTGCAGAGGAGAGAAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006442310 6:34060187-34060209 AGGAGTTGGGAGATGATGGAGGG - Intronic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007556375 6:42770033-42770055 GGGGCTTTGCAGATCATGGAAGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008396436 6:51013075-51013097 AGGGGTTTGGAGATGAAGGAGGG - Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1009949233 6:70376367-70376389 AGGTATTTGTATATGTTGAATGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1011698987 6:89937837-89937859 AGTTATTTTCACATGTTGGATGG + Intronic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014895649 6:126896546-126896568 AGTTATTTGGGGATGATGGTAGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017143918 6:151216731-151216753 AGGTAGGTGCAGATCCTGGAGGG + Intergenic
1017559306 6:155609894-155609916 AGGAATTTGCACCTGATGCAGGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019345618 7:528856-528878 AGGGATTGATAGATGATGGATGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021253138 7:18356693-18356715 CGGTATTTGCACATGGGGGAGGG + Intronic
1021665917 7:22979639-22979661 AGGGATTTAGAGATGAGGGAGGG - Intronic
1022523477 7:31022678-31022700 TGGTCTTTCCAGATGCTGGAGGG + Intergenic
1023974472 7:45017912-45017934 AGGTATTTTCAGATAATAAAAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025282879 7:57641027-57641049 AAGTATTTGTAGATGAATGAAGG - Intergenic
1025301836 7:57824391-57824413 AAGTATTTGTAGATGAATGAAGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027602657 7:80258561-80258583 AGGTATTTGCTGTTTATGGAGGG + Intergenic
1028773320 7:94652282-94652304 AGGTGTTTACAGAATATGGAAGG + Intronic
1029012482 7:97276785-97276807 ATTTAATTGCTGATGATGGATGG - Intergenic
1029223709 7:99009617-99009639 AGGTATTTGCAGGAGAGGAATGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030903197 7:115149627-115149649 ACGTCATTCCAGATGATGGAAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032314058 7:130817692-130817714 AGGTGTTTGCAGATGGCAGATGG + Intergenic
1032376526 7:131424942-131424964 AGGTGTGTCCAGATCATGGAAGG - Intronic
1033986592 7:147234170-147234192 AAGTATTTGGAGATGATGGATGG - Intronic
1034851109 7:154494859-154494881 AGGTACTTGCAGATTAAGGGAGG + Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036392496 8:8336363-8336385 AGGTTTTTGCAGGGAATGGATGG - Intronic
1036999579 8:13702559-13702581 ACGTATATGCAAATGATAGAAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039372066 8:36995086-36995108 ATCTAATTTCAGATGATGGAAGG - Intergenic
1039664933 8:39515320-39515342 AGGTTGTTACAAATGATGGATGG + Intergenic
1040890255 8:52309755-52309777 AGGTATTTGCAGGTAAAAGAAGG - Intronic
1041679711 8:60576400-60576422 ATGTATTTGGATATGCTGGAAGG - Intronic
1041800530 8:61792954-61792976 GGGATTTTGCAGATAATGGATGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042599069 8:70480064-70480086 AGATATGTGCAAATGATTGAAGG - Intergenic
1043380737 8:79699467-79699489 AGGTATTTGCTGGTGCTTGATGG - Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044153169 8:88808067-88808089 ATGTATTTCCAGAGGATGTAGGG + Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044601786 8:94012385-94012407 AGGAATTAACAGAGGATGGAAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1046066073 8:109197898-109197920 AATTATTTTCAGGTGATGGACGG - Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1048254096 8:132892252-132892274 AAGGATAGGCAGATGATGGATGG - Intronic
1049679261 8:143910252-143910274 AGGAATTTGCTGATCCTGGAAGG - Intergenic
1050274870 9:3986201-3986223 AGGTATTAGCAGAAGACAGAGGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050886371 9:10771666-10771688 AGGTTTTAGCAGGTGAAGGAAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052517041 9:29495238-29495260 AGGGATTTGGAGATGCTGAAAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056125861 9:83536439-83536461 ATGAATGTGTAGATGATGGAGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058630356 9:106980082-106980104 AGGTATTTGGAGAAGTTGAAAGG - Intronic
1058978151 9:110144015-110144037 TGATATTTGCAGATAATGAAGGG - Intronic
1058999113 9:110329904-110329926 AAGTATTTGCAGGAAATGGAAGG + Intronic
1061398835 9:130357502-130357524 ATGGATTGGTAGATGATGGATGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203633912 Un_KI270750v1:94308-94330 AAGTATTTGTAGATGAATGAAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186479762 X:9887724-9887746 AGTTATCTGCACATGATAGAAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189899276 X:45689271-45689293 AGTTATTTTCAGAGGAAGGAGGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197452152 X:126632724-126632746 GGGTATTTGCAGATGGTTAAGGG - Intergenic
1197596256 X:128467801-128467823 AAGTATTCGCACAAGATGGAAGG - Intergenic
1198135636 X:133747322-133747344 ATGTTTGTGCAGGTGATGGAAGG - Intronic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200686552 Y:6264465-6264487 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1200989427 Y:9335381-9335403 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1200992100 Y:9355714-9355736 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1200994753 Y:9375992-9376014 AGGTGGTTGCAGCTGAGGGACGG + Intronic
1200997416 Y:9396338-9396360 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1200999929 Y:9464874-9464896 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1201002589 Y:9485184-9485206 AGGTGGTTGCAGCTGAGGGACGG + Intronic
1201005245 Y:9505468-9505490 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1201007906 Y:9525797-9525819 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1201010522 Y:9545988-9546010 AGGTGGTTGCAGCTGAGGGACGG + Intergenic
1201685512 Y:16697554-16697576 GGGTCTGTTCAGATGATGGAGGG - Intergenic