ID: 990256708

View in Genome Browser
Species Human (GRCh38)
Location 5:53977962-53977984
Sequence GGCTTTTCGCCTATAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990256705_990256708 -2 Left 990256705 5:53977941-53977963 CCACTTAAATGGAAGGTCTGAGG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 990256708 5:53977962-53977984 GGCTTTTCGCCTATAATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990256708 Original CRISPR GGCTTTTCGCCTATAATAGG AGG Intronic
913964071 1:143360363-143360385 GACTTTCCGCCTCTAAGAGGGGG + Intergenic
914058436 1:144185967-144185989 GACTTTCCGCCTCTAAGAGGGGG + Intergenic
914120712 1:144780404-144780426 GACTTTCCGCCTCTAAGAGGGGG - Intergenic
916401068 1:164448885-164448907 GCCTCTTGGCCTATAATGGGAGG + Intergenic
920500703 1:206483222-206483244 GGCTCTTCACCTATAAAACGAGG - Intronic
920926823 1:210349275-210349297 GGCTTGTCTTCTATAATTGGTGG + Intronic
1071722269 10:88159234-88159256 GGATGTTCGCCTATCAAAGGAGG - Intergenic
1072930950 10:99661343-99661365 GGATTTTTGCCTTTATTAGGAGG + Intronic
1078959569 11:16248721-16248743 GCCTTTTGGCCTGTAATGGGAGG + Intronic
1090576008 11:128104666-128104688 GGCTATTCACTTATAATAGTTGG - Intergenic
1100875604 12:98958281-98958303 GGATTTTTGACTATAATAGTTGG - Intronic
1117185554 14:53236801-53236823 GGCTTCTCTGCTACAATAGGTGG + Intergenic
1117255444 14:53972593-53972615 TGCTTCTCTCCTATTATAGGTGG - Intergenic
1121140775 14:91539606-91539628 GACTCTGGGCCTATAATAGGAGG + Intergenic
1122819017 14:104331884-104331906 GGCTTCTCTCCTCTAAGAGGAGG - Intergenic
1141041379 16:80675604-80675626 GGCTTTTCACCGACATTAGGAGG + Intronic
1141041388 16:80675668-80675690 GGCTTTTCACCGACATTAGGAGG + Intronic
1141041396 16:80675732-80675754 GGCTTTTCACCGACATTAGGAGG + Intronic
1148898828 17:50859356-50859378 TCCTTTTCGCCTATAATAGATGG - Intergenic
1157298307 18:46461778-46461800 GGTTTTTGTCCTATAATATGTGG + Exonic
1163505459 19:17703385-17703407 GGCTTATCGCCTATAAAATGAGG + Intergenic
1202697917 1_KI270712v1_random:138624-138646 GACTTTCCGCCTCTAAGAGGGGG + Intergenic
934279090 2:91595624-91595646 GACTTTCCGCCTCTAAGAGGGGG + Intergenic
935556582 2:104516425-104516447 GGCTTTGGGCCTATAATAATGGG - Intergenic
941176622 2:162205076-162205098 TGCGTTTGGCCTATAAAAGGTGG + Intronic
1171349065 20:24488938-24488960 GGCTTTTCACATAGAACAGGAGG - Intronic
1178634275 21:34288526-34288548 GGCTTTAGGTCTATAATGGGAGG + Intergenic
952615758 3:35271723-35271745 GGATTTTCTCCTTTATTAGGTGG - Intergenic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
967374192 3:188782428-188782450 GGTTTTTCATCTATAAAAGGAGG + Intronic
970028509 4:11650287-11650309 GCCTTATAGCCTATAAAAGGGGG + Intergenic
988863615 5:35310365-35310387 GGCTTTTCTCCTATATTATTTGG - Intergenic
990256708 5:53977962-53977984 GGCTTTTCGCCTATAATAGGAGG + Intronic
990505647 5:56441608-56441630 TGCTTTTTGCCCATAAAAGGAGG - Intergenic
990782598 5:59382836-59382858 GTATTTTCGCCTATAAAATGGGG + Intronic
1003788769 6:9518250-9518272 GGTTATTCCCCTAGAATAGGTGG + Intergenic
1005405323 6:25481294-25481316 GGCTTTTCCCCTAGAACAGTGGG - Intronic
1016260675 6:142166587-142166609 GGTTTTTCACCTATAAAAGGAGG - Intronic
1023866166 7:44239375-44239397 GGCTCCTCGCCTGTAAGAGGAGG - Intronic
1024458483 7:49635482-49635504 GGTTTTCCTCCTATAATATGGGG - Intergenic
1024662252 7:51509605-51509627 AGGTTTTGGCCTATAAGAGGAGG - Intergenic
1028852165 7:95550027-95550049 GGCTTTGTGACCATAATAGGAGG + Intergenic
1032500641 7:132397082-132397104 GGCTTTTAGCCTAAAATGGATGG - Intronic
1037441495 8:18920782-18920804 GGCTACTAGCCTTTAATAGGTGG - Intronic
1040526209 8:48227302-48227324 CCCTTTTTGCCTATTATAGGAGG - Intergenic
1051960325 9:22752953-22752975 GGCTTTTCTCCTGGAACAGGAGG - Intergenic
1059597965 9:115743854-115743876 GTCTCTTCCCCTGTAATAGGTGG - Intergenic
1185571862 X:1140802-1140824 GGCTTTTGGCCTACAGTTGGGGG - Intergenic
1192080055 X:68039180-68039202 GTCTTTTCACCTATAAAATGGGG + Intergenic
1192923228 X:75729598-75729620 GCCTTTTGGCCTGTAATAGGAGG + Intergenic
1193653229 X:84165345-84165367 GGATTTTAGTTTATAATAGGGGG - Intronic
1194347600 X:92785299-92785321 GCCTCTGCGCCTATAATGGGAGG + Intergenic