ID: 990257950

View in Genome Browser
Species Human (GRCh38)
Location 5:53991045-53991067
Sequence TGGAATTATACCCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990257950_990257958 22 Left 990257950 5:53991045-53991067 CCCACCCCATGGGTATAATTCCA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990257950 Original CRISPR TGGAATTATACCCATGGGGT GGG (reversed) Intronic
904199944 1:28812968-28812990 CGGAAACATGCCCATGGGGTGGG + Intronic
904328430 1:29742583-29742605 TGGAACCATGGCCATGGGGTGGG - Intergenic
909181809 1:72433773-72433795 TGGAATCATAACCATAGGATTGG - Intergenic
909888537 1:80973448-80973470 TGCAAGTATATCCATGGTGTGGG - Intergenic
910115108 1:83723547-83723569 TGGAATTCCTCCCCTGGGGTAGG + Intergenic
912210442 1:107551173-107551195 TAGAATTATTCCAATGGGTTTGG + Intergenic
913157811 1:116117230-116117252 TGGAATTACATCCGTGGGGCTGG + Intronic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG + Intronic
1063872047 10:10427896-10427918 TGGAATTATACCTATTGGCAAGG - Intergenic
1065219215 10:23478958-23478980 TGGGATTATACGCATGAGCTTGG + Intergenic
1065746792 10:28849384-28849406 AGGAATTATACCCATAGACTTGG - Intronic
1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG + Intergenic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1071610178 10:87024741-87024763 TGGATTTATACCCATTTGGATGG + Intergenic
1073723750 10:106206028-106206050 GGGAATTATACACATGAGGCTGG - Intergenic
1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG + Intronic
1077677567 11:4209873-4209895 TGGAATTATGGCTATGGGCTTGG + Intergenic
1079125237 11:17714230-17714252 AGGATCTATACCCATGTGGTGGG + Intergenic
1081034485 11:38125121-38125143 TGGAATTATTCCAATAGAGTGGG - Intergenic
1081598084 11:44473133-44473155 TGCAATCATACCCATGGCTTTGG + Intergenic
1082672398 11:56051560-56051582 GGGAATTATACAGATTGGGTTGG - Intergenic
1086297873 11:85391377-85391399 TGGAATAGTACCAATGGGATTGG - Intronic
1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG + Intergenic
1087531677 11:99389746-99389768 TGGAATTTTCCCCAAGTGGTAGG + Intronic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1091707950 12:2712519-2712541 AGGAATTATACCAGTGGGCTAGG + Intergenic
1094383521 12:29869053-29869075 TGGACTTCTACACCTGGGGTTGG + Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1102499782 12:113344005-113344027 AGGAATTAGGCCCATGTGGTGGG + Intronic
1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1105899320 13:24742257-24742279 TGAAATCTTACCCATGGGGGTGG + Intergenic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1114732145 14:25004416-25004438 GAGAATTATACACATGGGGGAGG + Intronic
1117444053 14:55786955-55786977 TGGAAGAAGACCCGTGGGGTGGG - Intergenic
1117929476 14:60824950-60824972 TGGAATTGATCCAATGGGGTGGG - Intronic
1119174257 14:72557565-72557587 TGGAATTAGAGGCCTGGGGTGGG - Intronic
1122739882 14:103866163-103866185 TGGAATGAGGCCCTTGGGGTGGG + Intergenic
1124710561 15:32006607-32006629 AGGAATCTTAACCATGGGGTAGG + Intergenic
1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG + Intergenic
1132289802 15:100691716-100691738 TGGACTTTTACCCAAGGGATTGG - Intergenic
1134807568 16:17138923-17138945 TGGAATTTCACCCCTGGGGTAGG + Intronic
1141384841 16:83611327-83611349 TGAAATTAAACCTTTGGGGTAGG - Intronic
1151647805 17:75445413-75445435 AGGAACTACACCCATGGGATGGG - Intronic
1153538413 18:6128631-6128653 TGGAATTGTACCCATGGCTGAGG + Intronic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1161371359 19:3913707-3913729 TGAAATGCAACCCATGGGGTGGG - Intronic
1167850671 19:52199036-52199058 GGGAAATATACACATGGGCTAGG - Intronic
925062791 2:905797-905819 TGGCATTATACCCAGCTGGTGGG - Intergenic
930217348 2:48710212-48710234 TAGAAATATACCCAGGGGATGGG - Intronic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
935545275 2:104394614-104394636 TGGATTTATACCCGTGTGCTTGG - Intergenic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
936644184 2:114349732-114349754 TGGAATTATGCCCATGTCCTAGG - Intergenic
937702223 2:124876478-124876500 TGCAGTTATAGCCATGGGCTAGG + Intronic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
940470280 2:154089201-154089223 AGGAATTTTGCCCATGGAGTAGG - Intronic
940683897 2:156821981-156822003 TGGACTTTTACCCATCGTGTTGG - Intergenic
943729012 2:191282130-191282152 AGAGATTATACCCATGAGGTGGG - Intronic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
945292071 2:208136600-208136622 AGGAATCTTACCCATGGGGAGGG - Intergenic
945366072 2:208956148-208956170 TGGAATTCTAGCCATGAGATAGG + Intergenic
947755832 2:232564330-232564352 AGGAATTAAACCCATGTGGGAGG + Exonic
1169442442 20:5643969-5643991 TGGCATTAAAGCCATGGGATTGG - Intergenic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1178115790 21:29415073-29415095 TGGAATACTTCCCATGTGGTGGG + Intronic
1183296454 22:37032607-37032629 TGGAATTTAACCAATGGGTTTGG + Intergenic
1183611557 22:38910619-38910641 TGGAAACAAACCCATGGTGTTGG - Intergenic
1184618845 22:45658313-45658335 TGGAATTATACCAAATGGATAGG + Intergenic
951355355 3:21660444-21660466 TGGAAATAGAGCCATGGGGACGG + Intronic
954221107 3:49154474-49154496 TGGAATTATCACCATGGGGAAGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956304537 3:67809407-67809429 TTGAATAATGCCCATGGGCTGGG - Intergenic
960235677 3:115279477-115279499 AGGAATTAAACCCATGTGGGAGG + Intergenic
960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG + Intronic
961736887 3:129007636-129007658 AGGAAATAGACCCTTGGGGTTGG + Intronic
962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG + Intronic
963162341 3:142163698-142163720 TGAAATTACACCCATTGGCTGGG + Intronic
967242338 3:187452571-187452593 TGAATTTATACCTATGAGGTGGG - Intergenic
967570740 3:191025661-191025683 TAAAATTATCCCCATGGGGCTGG - Intergenic
976306278 4:83562977-83562999 TGAATTTATACACATGAGGTGGG + Intronic
979137504 4:117127985-117128007 TGGTAGCATACCCATGGTGTTGG + Intergenic
979928664 4:126601695-126601717 TGGTATTAAAGCCATGGGGCTGG + Intergenic
980516800 4:133874527-133874549 TGGAATTAAAGGCATGTGGTTGG - Intergenic
988366367 5:30305552-30305574 TGGAATGCTACACATGGGGTAGG + Intergenic
988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG + Intronic
988983305 5:36593309-36593331 TGGAACACTGCCCATGGGGTTGG - Intergenic
989066573 5:37468404-37468426 TGTAATTATCTCCATGTGGTAGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
992368147 5:76114250-76114272 TGGCATTATTCCCATGGTGATGG - Intronic
992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG + Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1005911586 6:30314765-30314787 TGGACATATACCTATGGAGTTGG - Intergenic
1016166503 6:140951958-140951980 TTGAATTATATCCAGGGGTTTGG - Intergenic
1016746823 6:147589648-147589670 TGGAGTCATACCCATGCAGTTGG - Intronic
1021459208 7:20866423-20866445 TAAAATTATACCCATGAGGCAGG - Intergenic
1021791047 7:24205854-24205876 TGGAATTGAAGCCATGGGATGGG + Intergenic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG + Intronic
1025115076 7:56250750-56250772 TGGAATTATACCTCTTGGATGGG + Intergenic
1026199330 7:68200621-68200643 TGGAATTATACCTCTTGGATGGG + Intergenic
1030085422 7:105811630-105811652 TGCATTTATAGCCATGGGGCTGG + Intronic
1031676478 7:124617668-124617690 GAGAGTTATACCCCTGGGGTAGG - Intergenic
1059027612 9:110652498-110652520 TGGTATAATACCTATGAGGTAGG - Intergenic
1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG + Intergenic
1186797928 X:13064553-13064575 TGGCATTATACTCATCTGGTAGG + Intergenic
1186907029 X:14121907-14121929 TGCAAGTATACCCATGGAGGAGG + Intergenic
1188527643 X:31103620-31103642 TGGAATTATATCCACTGGGCTGG + Intronic
1189269621 X:39741830-39741852 TGGAAATATACTCATGTGTTAGG + Intergenic
1189526238 X:41824931-41824953 AGGAATTATTGCCAAGGGGTTGG - Intronic
1189730619 X:44016498-44016520 GGGAGTGATACCCATGGGGCAGG - Intergenic
1192792359 X:74394990-74395012 TGTAATAATAGCCATGGGCTGGG - Intergenic
1194209400 X:91052282-91052304 TGGTATTGTACCCATGACGTGGG - Intergenic
1200218048 X:154377331-154377353 TGGAGGTTTGCCCATGGGGTGGG - Intergenic
1200784561 Y:7248952-7248974 TGGTCTTTTACCCATGTGGTTGG - Intergenic
1201413079 Y:13720974-13720996 TGGTATTATGACCCTGGGGTAGG - Intergenic