ID: 990257958

View in Genome Browser
Species Human (GRCh38)
Location 5:53991090-53991112
Sequence GATAACTGAATTGAATGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990257950_990257958 22 Left 990257950 5:53991045-53991067 CCCACCCCATGGGTATAATTCCA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257956_990257958 2 Left 990257956 5:53991065-53991087 CCATTTTTGAAGTGGAAGCCAAT 0: 1
1: 0
2: 0
3: 26
4: 186
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257953_990257958 17 Left 990257953 5:53991050-53991072 CCCATGGGTATAATTCCATTTTT 0: 1
1: 0
2: 1
3: 26
4: 317
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257946_990257958 29 Left 990257946 5:53991038-53991060 CCCTACCCCCACCCCATGGGTAT 0: 1
1: 0
2: 1
3: 46
4: 298
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257947_990257958 28 Left 990257947 5:53991039-53991061 CCTACCCCCACCCCATGGGTATA 0: 1
1: 0
2: 5
3: 34
4: 344
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257954_990257958 16 Left 990257954 5:53991051-53991073 CCATGGGTATAATTCCATTTTTG 0: 1
1: 0
2: 1
3: 21
4: 254
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257948_990257958 24 Left 990257948 5:53991043-53991065 CCCCCACCCCATGGGTATAATTC 0: 1
1: 0
2: 4
3: 11
4: 138
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257949_990257958 23 Left 990257949 5:53991044-53991066 CCCCACCCCATGGGTATAATTCC 0: 1
1: 0
2: 1
3: 6
4: 91
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257951_990257958 21 Left 990257951 5:53991046-53991068 CCACCCCATGGGTATAATTCCAT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145
990257952_990257958 18 Left 990257952 5:53991049-53991071 CCCCATGGGTATAATTCCATTTT 0: 1
1: 0
2: 1
3: 30
4: 259
Right 990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG 0: 1
1: 0
2: 0
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990257958 Original CRISPR GATAACTGAATTGAATGTAC TGG Intronic
900073063 1:789450-789472 AAGAATTGAATTGAATGGACTGG + Intergenic
901105470 1:6752389-6752411 GATAAGTGAACAGAATGTAGAGG + Intergenic
910222808 1:84905269-84905291 GATAAATGTGCTGAATGTACAGG - Intergenic
912011483 1:104969797-104969819 GATAAGTGAACAGAATGTAGAGG + Intergenic
918032663 1:180831004-180831026 GATAAATGTATTAAATGTATTGG - Intronic
918671395 1:187221680-187221702 AATAACTGCATTGAATGTAAAGG - Intergenic
920644295 1:207787824-207787846 GATAGCTGAACTGAATGTGAGGG + Intronic
922268656 1:224012428-224012450 AAGAATTGAATTGAATGGACTGG + Intergenic
924088031 1:240473699-240473721 TATAACTGTATTGAATGTGGAGG + Intronic
1063419728 10:5902163-5902185 GAGAACTGACTTGAAAGGACAGG - Intronic
1063783921 10:9358480-9358502 GATACCTGTTTTGAATGAACTGG - Intergenic
1064759079 10:18600302-18600324 GATTACTGAAATTATTGTACAGG - Intronic
1066775397 10:38881719-38881741 TAGAACGGAATTGAATGTAATGG + Intergenic
1068197319 10:53733707-53733729 GATATCTGTACTGAATTTACAGG + Intergenic
1068498016 10:57809219-57809241 CATAGCTAAAGTGAATGTACAGG - Intergenic
1068814549 10:61294946-61294968 GATAACTGAATTCACTAAACAGG - Intergenic
1079878042 11:25885815-25885837 GATAACTGAATGAAATGTTCAGG + Intergenic
1080437731 11:32261841-32261863 GATAACTCATTTGATTTTACAGG - Intergenic
1081046916 11:38286098-38286120 GATATCTGAATTAACTTTACAGG + Intergenic
1082916183 11:58440004-58440026 GATGATTGAATTGATTCTACTGG - Exonic
1085614449 11:77985191-77985213 GATAAAGGAATTGGATGGACTGG - Intronic
1087084708 11:94204577-94204599 GATAGCTGACTTGACTGTACAGG + Intergenic
1087114410 11:94509425-94509447 GAAAATTCAAATGAATGTACAGG - Intergenic
1087820461 11:102705932-102705954 TATTACTGAATTGAATATACTGG + Intergenic
1088022682 11:105138752-105138774 CATAACTGAATTCAAGATACAGG + Intronic
1088428500 11:109731209-109731231 AATAACAGAATTGTATGTACTGG + Intergenic
1092475555 12:8815944-8815966 CAAAACTCAATTGAATATACTGG + Intergenic
1093161077 12:15747458-15747480 GATTACTGAATTGGTAGTACTGG - Intronic
1093669189 12:21852466-21852488 GATCACTCAAGTGAATGTCCAGG + Exonic
1094044315 12:26150493-26150515 GATATATAAATTGTATGTACAGG - Intronic
1094749933 12:33394267-33394289 GTTTACTGAATTAAATGTGCAGG + Intronic
1095538691 12:43282657-43282679 GGTAACTGAAATGATTGCACTGG + Intergenic
1100822693 12:98446198-98446220 GATCAGTATATTGAATGTACTGG - Intergenic
1108131098 13:47301118-47301140 AGTAACTGAATTAAATATACTGG - Intergenic
1108838527 13:54582175-54582197 GATGACTGAATTCAAGGTGCTGG + Intergenic
1108863825 13:54897281-54897303 GATAAGTGAACAGAATGTAGAGG - Intergenic
1110701009 13:78548935-78548957 AATAACTGAACTGAAGGTAATGG + Intergenic
1115925769 14:38431808-38431830 GAAAACTGTAATGAATGTATGGG - Intergenic
1115981905 14:39061996-39062018 TATAACTGTTTTGAATGCACTGG - Intronic
1118956488 14:70487828-70487850 AAAAACTGAATAGAAAGTACAGG - Intergenic
1121213173 14:92224853-92224875 GATAGCTGAATTAAATTTAAAGG - Intergenic
1123788907 15:23700281-23700303 GAAAAGTGAATTAAATGAACAGG - Intergenic
1127231663 15:57002919-57002941 AATCAGTGAATTGAATTTACTGG + Intronic
1135168662 16:20164006-20164028 GAAAAATGGATTGAATGGACTGG - Intergenic
1139232540 16:65297971-65297993 GATAGCTGTATTTGATGTACTGG - Intergenic
1145701302 17:26832512-26832534 TGTAATTGAATGGAATGTACCGG + Intergenic
1148506509 17:48131523-48131545 GATAACTGCATGGAATGAAAAGG - Intergenic
1148762350 17:50013132-50013154 AATAACTGTGTAGAATGTACTGG + Intergenic
1149806840 17:59625997-59626019 GATACCTGAATAAAATGTACTGG - Intronic
1203175612 17_KI270729v1_random:10790-10812 TATAATGGAATTGAATGAACTGG - Intergenic
1203176357 17_KI270729v1_random:22229-22251 TATAACTGAATGGAATGGAATGG + Intergenic
1203176669 17_KI270729v1_random:24103-24125 TATAACTGAATGGAATGGAATGG + Intergenic
1203176716 17_KI270729v1_random:24403-24425 TATAACTGAATGGAATGGAATGG + Intergenic
1153858688 18:9175959-9175981 AATAACTAAATTGACTGTTCAGG - Intronic
1159778918 18:72638393-72638415 GAGAAATGAATTGAATTTACTGG - Intronic
1159829593 18:73258701-73258723 GATAACTGGACTTAATTTACAGG + Intronic
1160142564 18:76338650-76338672 GATAAGTGAACAGAATGTAGAGG - Intergenic
1163132576 19:15284688-15284710 GACAACTGAACTGAATCTGCTGG + Intronic
927219235 2:20691550-20691572 GATAACTGCCATGAAAGTACTGG + Intronic
928794351 2:34997976-34997998 GATAAATGAACAGAATGTAGAGG - Intergenic
929480915 2:42307363-42307385 GATAACTAAATTGAAAGTGCTGG + Intronic
931589463 2:63866009-63866031 GAAAACTGAATTGAATGCTTTGG + Intronic
936166914 2:110128854-110128876 GATAAATCAATTGAATTTGCAGG - Intronic
938179035 2:129163109-129163131 GATAAATGAATTGAAGTCACAGG + Intergenic
938674916 2:133622742-133622764 GAGAACTGCATTGAATTTATAGG - Intergenic
939634899 2:144570280-144570302 GATATCTGAATTAACTGTAATGG - Intergenic
939885699 2:147679196-147679218 GATGACTGACTTGAATGTGGAGG + Intergenic
939963140 2:148583990-148584012 GATAATTGTGTTGAAAGTACTGG - Intergenic
941718095 2:168784952-168784974 AATGACTGAATTGCTTGTACTGG - Intergenic
944124101 2:196274052-196274074 ACTGACTGTATTGAATGTACTGG + Exonic
944176300 2:196831904-196831926 GATAAGTGAACAGAATGTAGAGG - Intergenic
944287814 2:197971968-197971990 GATAACCAAAATGCATGTACTGG - Intronic
945960687 2:216131557-216131579 GATAAGTTAATTGAATTTAAGGG + Intronic
946976359 2:225156672-225156694 GATAGCTGGATAGAATGCACTGG - Intergenic
1171915695 20:31060653-31060675 TGTAACTGAATGGAATGTAATGG + Intergenic
1171924220 20:31175732-31175754 TATAACTGAACTGAATGAAAAGG + Intergenic
1173427552 20:42956074-42956096 GTTAACTCTATTGCATGTACAGG + Intronic
1173590136 20:44218400-44218422 AACAACTGAAGTGTATGTACAGG + Intergenic
1174924252 20:54740171-54740193 GATAACTGACTTGAGTTTTCCGG + Intergenic
1177794516 21:25759683-25759705 GATAAGTAAGTTGAATGTCCTGG + Intronic
1178912895 21:36690420-36690442 GATACCTGAATGGAGTGTAGTGG - Intergenic
1203298213 22_KI270736v1_random:58781-58803 GATAACGGAATTCAATGGAATGG + Intergenic
949554473 3:5141152-5141174 GATAAGTGAACAGAATGTAGAGG - Intronic
955597230 3:60604847-60604869 GATAACAGAATGGAATCTATAGG - Intronic
958455059 3:94320366-94320388 GATCACAGAATTTAATGTGCTGG + Intergenic
958675779 3:97266388-97266410 CAAAACTGAATTAAATGTAATGG + Intronic
959753391 3:109865569-109865591 GATGGCTTAATTGGATGTACTGG - Intergenic
960218294 3:115070898-115070920 GAAAACTGAATTTAAAGTTCAGG + Intronic
960675124 3:120186115-120186137 GTTAATTGAATAGTATGTACTGG + Intronic
961625236 3:128257634-128257656 GAAAACTAAATTGAATGCTCTGG - Intronic
963540806 3:146585149-146585171 ATTAATTTAATTGAATGTACTGG + Intronic
963914637 3:150846992-150847014 GCTAACTGAATTGACTGGATTGG - Intergenic
964591686 3:158369830-158369852 TATAACTCAATTGAATTCACAGG - Intronic
964852588 3:161110684-161110706 GATAACTGGACATAATGTACTGG - Intronic
965310460 3:167120913-167120935 GACAACTGAATTAAATTTTCTGG + Intergenic
970270659 4:14343802-14343824 GATAACTGCATTGGATTTACAGG - Intergenic
971358740 4:25917306-25917328 GTTCACTGGATTGAATTTACAGG + Intronic
971492019 4:27223217-27223239 GATAACAGAATAGAAAGTCCAGG - Intergenic
972046918 4:34677451-34677473 AATTATTGAATTGAATGTACAGG - Intergenic
974592233 4:63967957-63967979 GATGACTGAATTTAAAGTACAGG - Intergenic
974592240 4:63968202-63968224 GATGAATGAATTCAAAGTACAGG - Intergenic
982726010 4:158907161-158907183 GGTAAGTGAAATGAATGTAAAGG + Exonic
987489587 5:18560615-18560637 TATACCTGATTTGAATGTAATGG + Intergenic
987921744 5:24292266-24292288 TATAACTTAAGTGAATGTAATGG - Intergenic
990039640 5:51363580-51363602 GATCAATGAATAGAAGGTACTGG + Intergenic
990217870 5:53553877-53553899 TTTAACTGAATAGAATATACAGG - Intergenic
990257958 5:53991090-53991112 GATAACTGAATTGAATGTACTGG + Intronic
993061967 5:83049606-83049628 AATAAGTGCATTGAAGGTACGGG - Intergenic
994506325 5:100646844-100646866 GATAAGTGAACAGAATGTAGAGG - Intergenic
998263704 5:140650899-140650921 TATAACTGAATTAAATTTACAGG + Intronic
998949108 5:147373985-147374007 GAAAACTGAATTGGTTCTACAGG - Intronic
1000716218 5:164648090-164648112 GATAACTGAATCCAATTTATTGG - Intergenic
1001347128 5:170914118-170914140 GATCACTGAATTGAAAGTAATGG + Intronic
1003018931 6:2493037-2493059 GTTAACTGAAATGACTGTATGGG + Intergenic
1005116781 6:22347451-22347473 GATAAATGAATTCTATGCACTGG + Intergenic
1007255314 6:40524248-40524270 GATAACTGAATTGACTCTGATGG - Intronic
1008490473 6:52081678-52081700 GATAACTTAGTTGAATGTTCAGG + Intronic
1008943171 6:57069594-57069616 GATAAGTGAACAGAATGTAGAGG - Intergenic
1009535849 6:64883799-64883821 GTTGACTGAATTTAATGAACAGG - Intronic
1011501747 6:87997974-87997996 GATAAGTGAACAGAATGTAGAGG - Intergenic
1015205696 6:130636065-130636087 CATAACTGAATTTAATGAACAGG - Intergenic
1016073129 6:139764477-139764499 AACAACTGAATTGAATTTATTGG + Intergenic
1016422278 6:143898029-143898051 GACAATTGAAATGAATGCACAGG + Intronic
1018166009 6:161097651-161097673 GATAACTGCCTTGAATGTGGTGG + Intronic
1018591947 6:165435588-165435610 TAAAACTTAAATGAATGTACAGG + Intronic
1022087745 7:27085575-27085597 GATAACTGAATGAAATGCATGGG + Intergenic
1024427668 7:49246187-49246209 CATAACTGAAATGAATGTTATGG - Intergenic
1027199312 7:76053083-76053105 GATAACGGAATAGAATGAAGAGG + Intronic
1027405808 7:77859310-77859332 GATAACTGAAGTATATTTACTGG + Intronic
1028771978 7:94636462-94636484 GATAACAAAATTGAACGTAGAGG + Intronic
1031651586 7:124297756-124297778 AATAACTATATTGAATGTAAAGG - Intergenic
1032380468 7:131474511-131474533 AATAAGTGAACTGTATGTACTGG - Intronic
1032627981 7:133613682-133613704 GATAAATGAATTCAGTGTAAGGG + Intronic
1038630353 8:29236565-29236587 GATTACTGACTTGTATATACAGG + Intronic
1041492636 8:58451833-58451855 GATAACTGAATAGAATGAATGGG - Intergenic
1041733032 8:61081889-61081911 GAAAGCTGAATGGGATGTACTGG - Intronic
1042012677 8:64265620-64265642 GACTAGTGAATTGAATGAACAGG - Intergenic
1042926829 8:73975762-73975784 GATAACTTAATTGAATCATCGGG - Intronic
1046716867 8:117577503-117577525 GACAACAGAATTCAATATACTGG - Intergenic
1047136038 8:122079466-122079488 GAAAAATGAATGGAATGTCCGGG - Intergenic
1047311904 8:123699079-123699101 GATAACGGAAGTGACGGTACAGG - Intronic
1050561454 9:6838892-6838914 AATAACTAAATTGAAAGTTCTGG - Intronic
1051520866 9:17986345-17986367 GACAACTGAATTGAATGAATGGG - Intergenic
1053554111 9:39116782-39116804 GAAAACTCACTTGAATCTACTGG - Intronic
1053818215 9:41936907-41936929 GAAAACTCACTTGAATCTACTGG - Intronic
1054108476 9:61080566-61080588 GAAAACTCACTTGAATCTACTGG - Intergenic
1054612381 9:67250559-67250581 GAAAACTCACTTGAATCTACTGG + Intergenic
1055971262 9:81915241-81915263 GGTATGTGAATTGAATGCACTGG + Intergenic
1060226935 9:121797775-121797797 GATAACAGAATTGTATGTGCAGG + Intergenic
1203722006 Un_GL000216v2:20214-20236 TATAACAGAATGGAATGAACTGG - Intergenic
1203723395 Un_GL000216v2:29992-30014 TATAACAGAATGGAATGAACTGG - Intergenic
1203677400 Un_KI270756v1:34560-34582 TAGAACGGAATTGAATGTAATGG - Intergenic
1203679669 Un_KI270756v1:53109-53131 TGTAACTGAATGGAATGGACCGG - Intergenic
1186552279 X:10518857-10518879 TATTACTGAATTGATTGTAGTGG - Intronic
1186577646 X:10783575-10783597 TGTAATTGAATTAAATGTACAGG + Intronic
1188279558 X:28248047-28248069 GAGGACTGAATTGACAGTACTGG - Intergenic
1193285081 X:79703595-79703617 AATAACATAATTAAATGTACAGG + Intergenic
1194994518 X:100577115-100577137 GATAAGTGAACAGAATGTAGAGG - Intergenic
1195046255 X:101057201-101057223 GATAATTGAGTTGAATGCATAGG + Intergenic
1198931324 X:141864350-141864372 GATAATAAAAATGAATGTACAGG + Intronic
1201114419 Y:10824526-10824548 GGAAACGGAATTGAATGTAGTGG - Intergenic
1201207432 Y:11645826-11645848 CCTAACTGAATTGAATGGAATGG + Intergenic
1201211961 Y:11689021-11689043 TATAAAGGAATTGAATGTAATGG + Intergenic
1202610129 Y:26671708-26671730 TATAATTGAATTGAATGGAGTGG + Intergenic