ID: 990259114

View in Genome Browser
Species Human (GRCh38)
Location 5:54002228-54002250
Sequence AAAGGGCACCATTATTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990259114_990259120 28 Left 990259114 5:54002228-54002250 CCAATTTAATAATGGTGCCCTTT 0: 1
1: 0
2: 1
3: 18
4: 205
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259114_990259118 24 Left 990259114 5:54002228-54002250 CCAATTTAATAATGGTGCCCTTT 0: 1
1: 0
2: 1
3: 18
4: 205
Right 990259118 5:54002275-54002297 AGTCGTCCTCTAAACATTAATGG 0: 1
1: 0
2: 0
3: 6
4: 40
990259114_990259119 27 Left 990259114 5:54002228-54002250 CCAATTTAATAATGGTGCCCTTT 0: 1
1: 0
2: 1
3: 18
4: 205
Right 990259119 5:54002278-54002300 CGTCCTCTAAACATTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990259114 Original CRISPR AAAGGGCACCATTATTAAAT TGG (reversed) Intronic
901228096 1:7626156-7626178 AGAGGGAATCATGATTAAATTGG - Intronic
906138523 1:43518454-43518476 AAAGAGCACCATTAGGAAAGTGG - Intergenic
907585302 1:55611617-55611639 ACAGTGCCCTATTATTAAATGGG - Intergenic
908105721 1:60839753-60839775 TCACGGCATCATTATTAAATAGG - Intergenic
910776570 1:90882241-90882263 GAAGGGGACCATTATTACATGGG + Intergenic
911390738 1:97238044-97238066 AAAGGGCAACATTATTACACAGG + Intronic
916459202 1:165005178-165005200 AAAGGGCACCATCAAGAAAGTGG + Intergenic
917999647 1:180480151-180480173 AAGGGGAACCACTTTTAAATGGG + Intronic
918655695 1:187023458-187023480 AAAAGTCTCCATTAATAAATGGG + Intergenic
921549416 1:216515429-216515451 AATGGGCACCATATTTAATTAGG - Intronic
922410455 1:225369284-225369306 AAAAGGCAAGACTATTAAATTGG + Intronic
923702306 1:236311584-236311606 AAAGGGCACCAATTTTAGAAGGG - Intergenic
923835829 1:237609713-237609735 CAAGGGCAGCAATTTTAAATGGG - Intronic
924820251 1:247482577-247482599 AAAGGAAACCATCAGTAAATAGG + Intergenic
1063809677 10:9690682-9690704 AAAGGCAACCATTATTATAAAGG - Intergenic
1064867126 10:19893607-19893629 AAAAGGAGCCATTATTATATTGG - Intronic
1065085952 10:22176554-22176576 AAAAGGCAAGATTATTACATAGG + Intergenic
1071345647 10:84689387-84689409 AAAGGGAAACATGAATAAATAGG - Intergenic
1072678525 10:97487804-97487826 AAAGGGCAACAATTTAAAATGGG + Intronic
1073695653 10:105863992-105864014 AAAGGGCAACATCATTAAAAGGG + Intergenic
1077202730 11:1319685-1319707 AAAAGGAACCATTTTGAAATAGG + Intergenic
1078600136 11:12723088-12723110 AAAGGGCACAATTATTTTTTTGG + Intronic
1079526113 11:21390207-21390229 AAAGGGCCAAATTCTTAAATAGG - Intronic
1080534471 11:33207996-33208018 AAGGGGCACCATTATTTACCAGG + Intergenic
1081432606 11:42992691-42992713 AAAGTGAAACATTTTTAAATTGG + Intergenic
1085000502 11:73029081-73029103 AAAGGGCACCATAAATATAATGG + Intronic
1085366909 11:75956337-75956359 AAATGGCACTATTATTTATTAGG + Intronic
1085548096 11:77339590-77339612 AAAGGGGACCATTATTTTCTAGG + Intronic
1086487144 11:87318522-87318544 AAAGGGAAGGATAATTAAATTGG - Intronic
1087156390 11:94909031-94909053 AAGCAGCACCATTTTTAAATGGG - Intergenic
1087979079 11:104588875-104588897 AAAAGGAAACATTCTTAAATTGG + Intergenic
1088352566 11:108906730-108906752 AAGATGCACCATTATTTAATAGG + Intronic
1088479248 11:110279099-110279121 AAATGGTAACATTGTTAAATGGG - Intronic
1090944578 11:131418585-131418607 TAGGGGCACCATGATTAAATTGG + Intronic
1100005146 12:89886256-89886278 AAAGTGCACCATTCTTTAAAGGG + Intergenic
1100026294 12:90132635-90132657 ATAAGGCAGCATTATTAAAATGG + Intergenic
1100862445 12:98820737-98820759 AAAGAGCACCAGTGTTAACTAGG + Intronic
1101196169 12:102385095-102385117 AAAGGGAACCATTTTGAAATAGG - Intergenic
1103080870 12:118023100-118023122 AAAGGGTACCATTAGTAGAAAGG - Intronic
1106983984 13:35322777-35322799 AAATCTAACCATTATTAAATGGG - Intronic
1107381465 13:39861193-39861215 AAAGGGCATCATTATTCACCAGG - Intergenic
1108789540 13:53950815-53950837 AAAGTGCATGATTATTAAAGTGG - Intergenic
1109499918 13:63220966-63220988 AAAGGACATTATTAATAAATTGG - Intergenic
1109870960 13:68332883-68332905 AAAAGTTACCATTATTAAGTTGG - Intergenic
1109984259 13:69956432-69956454 AAAGGGAACCAGCATTAGATGGG + Intronic
1112491758 13:99872122-99872144 AGTGGGCAACAATATTAAATGGG + Intronic
1113873085 13:113575207-113575229 AAAAGGCACAAATATTGAATAGG - Intergenic
1115933192 14:38521382-38521404 AAAGGACAAAATTATTAAAATGG + Intergenic
1119929799 14:78534037-78534059 AAAGTGCACCATTACTTAATGGG - Intronic
1121979268 14:98440151-98440173 AAAGGGCACCATATTGAAAGTGG + Intergenic
1126119320 15:45237190-45237212 AAAGGGCAAAATCATTACATGGG - Intergenic
1126835482 15:52659917-52659939 AAAGGAGACCATTGTGAAATAGG + Intronic
1128957329 15:71962129-71962151 AAAATGCACCATAAATAAATGGG + Intronic
1130117837 15:81020858-81020880 CAAGGGCACCATTTTTAAAATGG - Intronic
1131661290 15:94520499-94520521 GAAGGGCACCAGAATTAATTAGG + Intergenic
1133438965 16:5804678-5804700 AAAGGCCACCGTAATTAATTAGG - Intergenic
1133484620 16:6207619-6207641 GAAGGGCATTATTATTCAATAGG - Intronic
1134435200 16:14250508-14250530 AAAGGGGACCAGTTTTACATGGG + Intronic
1135076251 16:19396277-19396299 AAAGGGCAAAATCATTACATGGG - Intergenic
1135516166 16:23136883-23136905 AAAGTGCATCATTATTCATTAGG + Intronic
1136164807 16:28446409-28446431 AAAGGTCACCATTGGTAGATTGG + Intergenic
1136198159 16:28668572-28668594 AAAGGTCACCATTGGTAGATTGG - Intergenic
1136214505 16:28782748-28782770 AAAGGTCACCATTGGTAGATTGG - Intergenic
1136259227 16:29062592-29062614 AAAGGTCACCATTGGTAGATTGG - Intergenic
1137468053 16:48729162-48729184 CAAGGGCTGCATTTTTAAATAGG - Intergenic
1137698106 16:50476212-50476234 AAACGGCAGCATTTTTAAGTGGG - Intergenic
1140450585 16:75067682-75067704 AAGGGGCACCATGAATCAATGGG + Intronic
1141745868 16:85925914-85925936 AAAAGGCTCCATTATGAAGTAGG - Intergenic
1141786297 16:86203052-86203074 GAAGGGCACTATTATTAAATTGG + Intergenic
1142635498 17:1254655-1254677 AAAGAAAACCATCATTAAATGGG - Intergenic
1146578695 17:34016483-34016505 ACAGCGCAACATTATGAAATAGG + Intronic
1146589006 17:34111649-34111671 ATATGGCACCATTATTATAAGGG + Intronic
1147789242 17:43002998-43003020 AAAGGAGAACATTATTGAATAGG + Intergenic
1150896267 17:69214076-69214098 AAAAAGCATCATTATTCAATAGG + Intronic
1153647057 18:7204876-7204898 GAAGGGCACCATCATGACATTGG - Intergenic
1153808286 18:8729823-8729845 AAAAGGAATCATTCTTAAATTGG - Intronic
1153863682 18:9240731-9240753 AAAATGCTCCATTAATAAATAGG + Intronic
1154007140 18:10541440-10541462 AAAGTGAACCATTTTTAAGTTGG - Intronic
1154192213 18:12239731-12239753 GTAGGGCACCATTGTTGAATGGG - Intergenic
1157302994 18:46493533-46493555 AGTGTGCACCATTATTGAATAGG + Intronic
1159912096 18:74155169-74155191 AAAAAGCACCACTATTAAATAGG - Exonic
1160388999 18:78516153-78516175 AAAGGGAAACATTTTTAAAAGGG - Intergenic
1163659704 19:18569351-18569373 AAAAGACACCATTACTAAAAAGG + Exonic
1165176897 19:33936793-33936815 AAAGGGGACCTTGATTTAATTGG - Intergenic
1166453643 19:42922212-42922234 AAAGAGTACAATTATTAAAATGG - Intronic
1166606209 19:44145304-44145326 AAAAGGCACATTAATTAAATGGG - Intronic
925214251 2:2080361-2080383 AAAGGCCACCATCATGAAAATGG + Intronic
926849971 2:17185764-17185786 AAGGGGCACCAGGAATAAATTGG + Intergenic
927028937 2:19100508-19100530 AAGGGGAACCAATATAAAATAGG - Intergenic
929111616 2:38409711-38409733 AAAGGGCACCAGCATCAAACTGG + Intergenic
930605439 2:53488480-53488502 AGAGGGCAGCATAGTTAAATAGG + Intergenic
933416653 2:81995125-81995147 AAATGGCACCATTATTTTTTAGG - Intergenic
935431372 2:102979645-102979667 AAAGGGCACAGTTATAAATTTGG - Intergenic
937480340 2:122251790-122251812 AATGGGCAGCATTTTTTAATTGG + Intergenic
939098195 2:137861212-137861234 AAAGGGCTTCATTATGAGATGGG + Intergenic
940218984 2:151331636-151331658 AAAGGGAAAAATTAATAAATTGG - Intergenic
940837132 2:158535381-158535403 AAAGAGCAATATTCTTAAATGGG + Intronic
942448701 2:176095300-176095322 AAATGGCCACCTTATTAAATAGG + Exonic
942768154 2:179482138-179482160 AAAAGGGACCATTATTGATTAGG - Intronic
943848542 2:192685867-192685889 AAAGGGAAACATAATTTAATAGG + Intergenic
945599221 2:211837771-211837793 AAATGACAACATTAGTAAATGGG - Intronic
948096105 2:235335095-235335117 AAAGGGCAAAATTATTATCTTGG + Intergenic
1170486811 20:16826192-16826214 AAAGAACACATTTATTAAATAGG + Intergenic
1172129031 20:32643566-32643588 AAAGGGCACCATTGTCACATAGG + Intergenic
1173537418 20:43826599-43826621 AAAGGGAATCATTATTTAATGGG - Intergenic
1176699438 21:10025313-10025335 AAAGGGCATAATGATTGAATAGG + Intergenic
1178157922 21:29876023-29876045 AAAGGGCACCTTTGTCAACTAGG + Intronic
1179089347 21:38250137-38250159 AAAGGGCACAATTTTGCAATGGG + Intronic
1183141863 22:35949742-35949764 AAATGGCCCAATTATAAAATGGG - Intronic
952213127 3:31249510-31249532 AATGGGCACCTGTTTTAAATAGG + Intergenic
952422183 3:33142360-33142382 ACAGGACAACTTTATTAAATGGG - Intronic
955721390 3:61885087-61885109 AAAGAGCACGATTTTCAAATTGG - Intronic
956427199 3:69148656-69148678 AAAGGGGACCATTAAGAAACTGG + Intergenic
956849309 3:73213755-73213777 TAAGGGCACCAGTATTGATTAGG - Intergenic
957000370 3:74877158-74877180 AAGGGGCATCCTTATTAATTGGG + Intergenic
958511243 3:95051808-95051830 AAGAAGCACCATTATAAAATGGG - Intergenic
959109863 3:102109724-102109746 AAAAGGCATTATTATTAAATGGG + Intronic
959438973 3:106353132-106353154 AAACAGCACCATTAAAAAATGGG - Intergenic
959464906 3:106673630-106673652 AAAGTTCATCATTATAAAATTGG + Intergenic
962917268 3:139915948-139915970 AAAGGGAAACATTTTCAAATTGG - Intergenic
962979662 3:140476498-140476520 AAAAGGCACCAGTCTTAACTTGG + Intronic
963812413 3:149791038-149791060 AAAGGGAAGAAGTATTAAATAGG + Intronic
965133205 3:164727336-164727358 ATAGTACACCATGATTAAATTGG - Intergenic
965247576 3:166293663-166293685 AATGGAGACCATTATTAAAGTGG + Intergenic
965570005 3:170162909-170162931 AAAGGCCACCTTTATTAACAAGG + Intronic
966651351 3:182304392-182304414 AGAGGGCATCATTAATAACTGGG + Intergenic
968254110 3:197250077-197250099 AAAGGGCACCAAAATTGAAAAGG + Intronic
968279206 3:197462803-197462825 CAAGGGCTCCATTACTAATTCGG - Intergenic
971590194 4:28457784-28457806 AAAGGGCAACCATATTATATGGG - Intergenic
971603498 4:28626452-28626474 AGAGGGCAGCATGAATAAATTGG - Intergenic
973098960 4:46238105-46238127 AAATGGCACATTTATGAAATGGG - Intergenic
975892343 4:79044715-79044737 AAAGGGCACAATTTTGAAATTGG + Intergenic
976177015 4:82364835-82364857 AAAAGCCAGGATTATTAAATCGG - Intronic
976830486 4:89308579-89308601 AAAGAGCTTCATTATTAACTGGG + Intergenic
976966688 4:91051055-91051077 AGAGGGCAACATTCATAAATAGG + Intronic
977142067 4:93386425-93386447 ATAAACCACCATTATTAAATAGG + Intronic
977156689 4:93582669-93582691 TAAGGTCTCCATTATTAAACTGG - Intronic
977784946 4:101022097-101022119 AAAAGGCAACATTGTCAAATCGG - Intergenic
978105972 4:104902255-104902277 AAAATGCAGCATTATTCAATTGG - Intergenic
978259296 4:106734596-106734618 AGAGGGCACCAGTATTCACTGGG - Intergenic
978488849 4:109288518-109288540 AATGGGCACTATTATTAATAGGG + Intronic
980195425 4:129582483-129582505 AAAGGGCATCACTATTAAAAAGG - Intergenic
980371849 4:131883950-131883972 AAAGGGCATAATGATTGAATAGG + Intergenic
980998908 4:139809273-139809295 GAAGGGAAACATTTTTAAATGGG + Intronic
981004182 4:139858355-139858377 AAAGGGCATGTTTATCAAATTGG - Intronic
981055283 4:140353888-140353910 GAAGGGAACAATGATTAAATGGG - Intronic
983660512 4:170126707-170126729 AAAGGGCAAAATCATTACATGGG - Intergenic
983853144 4:172607924-172607946 AAATGACACCATTATAAAGTGGG - Intronic
986876071 5:12111715-12111737 AAAGAGCAACCTTATTATATTGG + Intergenic
987091761 5:14514032-14514054 AAAAGGCAAAAGTATTAAATCGG - Intronic
987845698 5:23280996-23281018 AAAGGAAACAATAATTAAATAGG + Intergenic
988640017 5:33031646-33031668 ATGGAGCACCATTATAAAATTGG + Intergenic
990259114 5:54002228-54002250 AAAGGGCACCATTATTAAATTGG - Intronic
990352080 5:54928980-54929002 AAAGTGGACCTTTATCAAATGGG - Intergenic
991523333 5:67526396-67526418 AAAGGACATCATTATGAAAATGG + Intergenic
992703990 5:79369432-79369454 ATAGGGAGCTATTATTAAATGGG + Intergenic
994657527 5:102612161-102612183 AAATGGCATTATTTTTAAATTGG - Intergenic
999508659 5:152224900-152224922 AAAGGGCTAAATTATTACATTGG - Intergenic
1000451216 5:161390137-161390159 AAAGGTCAACATGATTAAACTGG - Intronic
1000794725 5:165650785-165650807 AAAGGGTACCATGATTTACTCGG - Intergenic
1001101840 5:168820762-168820784 AAAAGGCACCTTTTATAAATTGG - Intronic
1003009507 6:2413510-2413532 AAATGGCTCCATTACTTAATAGG + Intergenic
1004521387 6:16364268-16364290 ATAGGGCACCATTTTAAAAATGG + Intronic
1005075322 6:21901416-21901438 AAAAGGAACAATAATTAAATAGG - Intergenic
1005588498 6:27300515-27300537 AAAGAGCACCACTAAGAAATAGG - Intronic
1007450820 6:41939636-41939658 AGGGGGCACCATTATCACATCGG + Intronic
1009044861 6:58226329-58226351 AAATAGCACCATTAAAAAATGGG - Intergenic
1009220676 6:60980647-60980669 AAATAGCACCATTAAAAAATGGG - Intergenic
1010160617 6:72849497-72849519 AAAAGGCACTGTTTTTAAATAGG + Intronic
1010493438 6:76502386-76502408 AAATGGCATCATTAACAAATTGG + Intergenic
1010758415 6:79693987-79694009 AAATGGCACCACTATTTACTGGG - Intronic
1011073040 6:83406507-83406529 AAATGGCACCCTCATGAAATGGG - Intronic
1012349107 6:98229592-98229614 AAATGGCAACATTTTTAAATGGG + Intergenic
1012905464 6:105059799-105059821 AAAGGGCAGCATCATTAAAGTGG - Intronic
1014837920 6:126181628-126181650 AAAGGGCACCATTGTTCCAGTGG + Intergenic
1014900785 6:126962201-126962223 ACAGGGCACAAGTATTAAATGGG - Intergenic
1015335624 6:132034514-132034536 AAAGGGCAAAATTATTATTTTGG - Intergenic
1016486100 6:144541394-144541416 AAAGGGCACAGTTGTTAATTTGG + Intronic
1017357872 6:153531165-153531187 AAATAGCCCCATTAATAAATGGG - Intergenic
1018641862 6:165911315-165911337 AAAGGGCAGCATTCCTAAAATGG + Intronic
1020424951 7:8054734-8054756 AAAGGAAACCATTAACAAATTGG - Intronic
1022034888 7:26524780-26524802 AAAAGGCACCAGAATTAGATGGG + Intergenic
1022436442 7:30390380-30390402 AAAGGGCATCATTTTTAGGTGGG + Intronic
1022840167 7:34156886-34156908 AAAGGGGACCATAATAAAAATGG - Intergenic
1023100982 7:36717992-36718014 AAAGGACACCATTATGAAAGTGG + Intronic
1023162498 7:37310689-37310711 AAAGGGCATCATAAACAAATTGG + Intronic
1024801108 7:53080271-53080293 AAAAGACAGCATTATGAAATGGG + Intergenic
1027771872 7:82417247-82417269 AAAGGGCACTATTAACAATTAGG + Intronic
1028506491 7:91576656-91576678 AAAGGGCATCATCAGTAAAGAGG - Intergenic
1028703180 7:93807411-93807433 AAAGGGCATCATCAGTAAAGAGG + Intronic
1031503793 7:122555772-122555794 AGAAGGCAGCCTTATTAAATTGG - Intronic
1031884608 7:127232811-127232833 AAAAGGTACTATTATTAACTGGG + Intronic
1033925470 7:146454059-146454081 AAAGTACATCATTATCAAATTGG + Intronic
1034503066 7:151463942-151463964 AAATGACACCATTATTCACTGGG - Intergenic
1034586399 7:152097162-152097184 AAATGGCACAATTTTAAAATGGG + Intronic
1034753130 7:153589448-153589470 ATAGCACACAATTATTAAATAGG - Intergenic
1036825729 8:11974434-11974456 ACAGGACACCAATATCAAATGGG - Intronic
1037895932 8:22655235-22655257 AAAGGACACCATTAAGAAAGTGG - Intronic
1038674908 8:29614904-29614926 CAAGGACACCATTAGAAAATGGG + Intergenic
1040004601 8:42609088-42609110 AAACGGCACCATTAATCAACTGG + Intergenic
1040353850 8:46596175-46596197 AAAGGGCTCCACTTTTAAAAAGG + Intergenic
1041075194 8:54162535-54162557 AAATGGTACCATTTTAAAATAGG - Intergenic
1043101819 8:76056843-76056865 ATAGGTCACCATTATAACATTGG - Intergenic
1043343021 8:79264768-79264790 AAAGCTAACCATTATTAAAGTGG + Intergenic
1044471971 8:92581110-92581132 TAATGGCACGATTATTTAATAGG - Intergenic
1047449078 8:124946532-124946554 AAAGGAAACTATAATTAAATAGG + Intergenic
1048042542 8:130745332-130745354 AATAGGCACCATTATTTTATGGG + Intergenic
1053769444 9:41453147-41453169 AAAGGGCATAATGATTGAATAGG - Intergenic
1054317414 9:63608581-63608603 AAAGGGCATAATGATTGAATAGG + Intergenic
1055797895 9:79995409-79995431 AAAGGTCACCATTAACAAATAGG - Intergenic
1056473772 9:86932106-86932128 AAAGGTAAACATTATTAAAAGGG + Intergenic
1056745108 9:89294781-89294803 AAATGGCATCATCATTAAGTAGG - Intergenic
1061696955 9:132383279-132383301 AAATGGAACAATTATTAAAGGGG + Intronic
1186268721 X:7861302-7861324 AAAGGTCACCATTAGAAAACAGG - Intergenic
1186355725 X:8787870-8787892 AAATGGCACCATTATAAAGAGGG - Intergenic
1186377460 X:9019992-9020014 AAATGGCACCATTATAAAGAGGG - Intergenic
1186968273 X:14811701-14811723 AAAGTGTCCCATTATTATATGGG - Intergenic
1188766129 X:34093823-34093845 AAAGATCAACATTATCAAATGGG + Intergenic
1189887096 X:45558626-45558648 AAATAACCCCATTATTAAATGGG - Intergenic
1193930905 X:87550647-87550669 AAAATCCACCATGATTAAATGGG + Intronic
1197315133 X:124956457-124956479 AAAGAGCATCATGATTAATTAGG + Intronic
1197857852 X:130935949-130935971 AAAGGGCACAAATATTGAAAAGG + Intergenic
1198729629 X:139715165-139715187 GAATGGTACCATTATTTAATAGG - Intergenic
1201377772 Y:13341019-13341041 AAAGGCCACCAATATCAAAAAGG + Intronic
1202575459 Y:26319784-26319806 AAAGAGCACCATTAAAAAAGAGG + Intergenic