ID: 990259115

View in Genome Browser
Species Human (GRCh38)
Location 5:54002245-54002267
Sequence TTCATTCATCTTTGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 388}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990259115_990259118 7 Left 990259115 5:54002245-54002267 CCCTTTATCCAAAGATGAATGAA 0: 1
1: 0
2: 4
3: 32
4: 388
Right 990259118 5:54002275-54002297 AGTCGTCCTCTAAACATTAATGG 0: 1
1: 0
2: 0
3: 6
4: 40
990259115_990259119 10 Left 990259115 5:54002245-54002267 CCCTTTATCCAAAGATGAATGAA 0: 1
1: 0
2: 4
3: 32
4: 388
Right 990259119 5:54002278-54002300 CGTCCTCTAAACATTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
990259115_990259120 11 Left 990259115 5:54002245-54002267 CCCTTTATCCAAAGATGAATGAA 0: 1
1: 0
2: 4
3: 32
4: 388
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259115_990259122 27 Left 990259115 5:54002245-54002267 CCCTTTATCCAAAGATGAATGAA 0: 1
1: 0
2: 4
3: 32
4: 388
Right 990259122 5:54002295-54002317 TGGAGGGACACAAAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990259115 Original CRISPR TTCATTCATCTTTGGATAAA GGG (reversed) Intronic
901141884 1:7040043-7040065 TTCAATCTTCTTTAAATAAATGG + Intronic
903255218 1:22093245-22093267 TTCAATGATCTATGGATTAAAGG - Intergenic
903944813 1:26955578-26955600 TTCATTCATCTTTGGTTCTACGG - Intronic
905767598 1:40614466-40614488 TTATGTCATCTTTGGAGAAATGG + Intergenic
906121338 1:43393794-43393816 TTTATTCATCTTGGTATAAATGG + Intronic
907517793 1:55004225-55004247 TTCATTCATCAGTGGATACTTGG + Intronic
909045395 1:70703522-70703544 GTCATTCAAGTTTGGATGAATGG + Intergenic
909163240 1:72181727-72181749 TTCATCCATCTTGTGACAAATGG - Intronic
909705703 1:78581212-78581234 TTCTTTCATATATGGATATAAGG + Intergenic
909996036 1:82280411-82280433 TTCATTCATCTCTTGATATTTGG + Intergenic
910404147 1:86868229-86868251 TTTAAACATCTGTGGATAAATGG + Intronic
911766831 1:101687026-101687048 TTGAATCATCTTTGGCCAAAAGG - Intergenic
912126201 1:106541705-106541727 TTCATACATCTTGTGATATAGGG - Intergenic
912643611 1:111370364-111370386 TACATTCATCTTTAGATATGTGG + Intergenic
913038041 1:114992981-114993003 ATGTTTCATCTTTGGAGAAATGG - Intronic
913109608 1:115646146-115646168 TTCATTTTGCTTTTGATAAAGGG + Intronic
914241074 1:145853572-145853594 CTCATTCATCTGTAGATAAAGGG + Exonic
914736299 1:150420511-150420533 TTCATTCATTTCTAAATAAATGG - Intronic
914820567 1:151099134-151099156 TTCATTCTTATTTAGATAGAAGG - Intronic
915101479 1:153503927-153503949 TCCATTCATTCATGGATAAATGG + Intergenic
916220662 1:162441753-162441775 ATCAGTCATCTTTTGAGAAATGG + Intergenic
916631290 1:166616122-166616144 TTCATTCATTTTTGGAAATTTGG + Intergenic
917150617 1:171940330-171940352 TTCATTCATCTCTTCATTAATGG + Intronic
917458609 1:175207753-175207775 TTAAGTAATCTTTGCATAAAAGG - Intergenic
918691771 1:187489400-187489422 TTCATTCATCAATTTATAAATGG - Intergenic
918704090 1:187639439-187639461 TTCATTCATTTTTGGATACAAGG - Intergenic
919360522 1:196587931-196587953 TTCATTCATCTTTTCAAAAATGG + Intronic
919697624 1:200594689-200594711 CCAATTCATCTTTGGATTAACGG + Intronic
921794229 1:219324295-219324317 TACACTCGTCTTTGGAGAAAAGG - Intergenic
921977530 1:221219061-221219083 TTCATTTAGCTGTGAATAAATGG + Intergenic
922952038 1:229566848-229566870 TTAATTTATTTTTGAATAAATGG - Intergenic
922962765 1:229662530-229662552 TTCATTTTTCTTTGGAGACAGGG + Intergenic
923648997 1:235854432-235854454 TTCATTCCTCTTTCAGTAAATGG + Intronic
924268460 1:242306634-242306656 TTGGTTCATTTCTGGATAAATGG - Intronic
1062956495 10:1543654-1543676 TTCATTCTTCAACGGATAAAGGG + Intronic
1063789598 10:9426800-9426822 TTATTTCATATTTGGACAAAAGG + Intergenic
1064118354 10:12597768-12597790 CTCCTTCATCTTTGGATAGAGGG - Intronic
1064711385 10:18129888-18129910 TACATTCATCAGTGGATGAATGG - Intergenic
1064714533 10:18163250-18163272 TTCATTCATCATCTGTTAAACGG - Intronic
1066229430 10:33418013-33418035 TTGATGCATCTTTGCATTAAAGG + Intergenic
1066564197 10:36702867-36702889 TTCACTTACCTTTGGATATAAGG - Intergenic
1066573336 10:36797661-36797683 TTCAGTGATCTTTGGATAAATGG - Intergenic
1066716441 10:38292091-38292113 TTGGTTCATTTCTGGATAAATGG + Intergenic
1067978216 10:51050553-51050575 TTCATCCATCTATGGATATTAGG + Intronic
1068199002 10:53758519-53758541 TTCATCCATCTTGTGACAAATGG - Intergenic
1068274532 10:54776264-54776286 TTAATTTTCCTTTGGATAAATGG + Intronic
1068545570 10:58341346-58341368 TTTATGCATTTTGGGATAAATGG + Intronic
1070190853 10:74110791-74110813 TTCATCATTCTTTGTATAAATGG + Intronic
1071585578 10:86817484-86817506 TTCATTCATCCATGGATACTTGG + Intronic
1071846898 10:89530082-89530104 TTCACTAATCTTTGGATATTGGG + Intronic
1072330579 10:94345959-94345981 TTTATTTATTTTTTGATAAACGG - Intronic
1072809127 10:98446077-98446099 ATCATTCATATTTGAATAGAGGG + Intronic
1073618420 10:105022131-105022153 TTCATACAGGTTTTGATAAAGGG - Intronic
1073990048 10:109252408-109252430 TTAATTCATCTGTGGATACAGGG - Intergenic
1074835632 10:117290339-117290361 TTAATTCAACCTTTGATAAAGGG + Exonic
1075326400 10:121535485-121535507 TTCCTTCATTTTTGGACACAAGG + Intronic
1076323445 10:129601402-129601424 TTCATTCTCCTTTGGCTTAAGGG + Intronic
1078338268 11:10480985-10481007 CTCATTCATCTTTGAATATGAGG + Intronic
1079431582 11:20394872-20394894 TTCATTCATATTTTCATATATGG + Intronic
1079723765 11:23852609-23852631 TTCATTAATCTCTTGATAACAGG + Intergenic
1079917715 11:26391341-26391363 TTAATTCATTTATGGATTAATGG - Intronic
1080507475 11:32930472-32930494 TTTTTTCATTTTTGGAAAAATGG - Intronic
1080921567 11:36714454-36714476 GGGATTCATGTTTGGATAAAGGG - Intergenic
1081056109 11:38412767-38412789 TTCATACATCATTGTAGAAATGG + Intergenic
1085760095 11:79234224-79234246 TTCATTCATCATTTGAACAATGG + Intronic
1085947774 11:81292543-81292565 TTTATTGATCTATGGATTAAAGG - Intergenic
1087369560 11:97265398-97265420 TTCATTTATCTTGGGAGTAAGGG + Intergenic
1088177782 11:107073523-107073545 TTCATTCATTTTAGGATGATTGG - Intergenic
1088970449 11:114770281-114770303 GCCATTTATCTTTGGATAATGGG + Intergenic
1091075882 11:132616143-132616165 TACCTTCATCTTTGGAGACATGG + Intronic
1091100342 11:132866775-132866797 TTTACTCATCTTTGAATCAAGGG - Intronic
1092076989 12:5682046-5682068 TTCCTTCTTCCTTGGCTAAAGGG - Intronic
1092545657 12:9449166-9449188 TGTATACATCTTTGGAGAAATGG - Intergenic
1093483220 12:19626532-19626554 TTCATAAATCTGTGGAGAAAAGG - Intronic
1094452733 12:30599823-30599845 TTCTTTCATCTTAGGTAAAAAGG - Intergenic
1094507298 12:31072881-31072903 TGTATACATCTTTGGAGAAATGG + Intergenic
1094582358 12:31745473-31745495 TGCATTTATCTTTGCAGAAAGGG + Intergenic
1094603422 12:31930426-31930448 TTTATTCATCTTTGTTTGAAGGG - Intergenic
1094621929 12:32088203-32088225 TTCATTCATTTTTGAAGACATGG - Intergenic
1096080388 12:48828729-48828751 CTCATACATCTTTGGAGAACCGG + Exonic
1097574803 12:61378586-61378608 TTCATTCATGTTTTGTGAAAAGG + Intergenic
1097585644 12:61512951-61512973 TTCCTTCATCTTTTTATAAATGG + Intergenic
1097669960 12:62523827-62523849 TCCATTTACCTTTGGATGAACGG + Intronic
1098172184 12:67758217-67758239 TCTATTCATCGTTGGATTAATGG + Intergenic
1098335035 12:69395245-69395267 ATCTTGCATATTTGGATAAATGG - Intergenic
1099272293 12:80525576-80525598 ATCATACATCTTTGGGTACATGG + Intronic
1099871403 12:88353593-88353615 TTCATTCATTTTTTGAAAAATGG - Intergenic
1101185458 12:102271966-102271988 TTCATCCATCTTTTAAAAAATGG + Intergenic
1101310514 12:103574651-103574673 CTCATTTATCTATGGACAAATGG - Intergenic
1101589569 12:106113708-106113730 TTAATTCCTCTGTGTATAAATGG - Intronic
1102187960 12:110964586-110964608 CTCTTTTATCTGTGGATAAATGG - Intergenic
1102741938 12:115215850-115215872 TGCATACAACTTTGGCTAAAAGG - Intergenic
1104102660 12:125628435-125628457 TTCTGTCTTCTTTTGATAAATGG + Intronic
1104779376 12:131410093-131410115 TTGATTCATGTTTGAATGAAGGG - Intergenic
1105032461 12:132893418-132893440 TACGTTCAACTTTGGATACATGG + Intronic
1106799355 13:33241487-33241509 TTCAGTCATGTATGTATAAATGG + Intronic
1106849185 13:33770550-33770572 TCCATTCATCTTTGGAGACAGGG - Intergenic
1106861386 13:33912605-33912627 TTCATTCATCTCTGGAGAGGAGG + Intronic
1107540072 13:41381211-41381233 TTCATCCATGTTGGCATAAATGG + Intergenic
1107582086 13:41801474-41801496 TCCATTCATTTCTTGATAAAAGG - Intronic
1107695194 13:42993016-42993038 TTCACTCATCTTTGTGTAGACGG - Intergenic
1107996136 13:45862953-45862975 TTCATTCATGTTTTGATAACTGG + Intergenic
1108093557 13:46877010-46877032 TGCAATCATCTCTGGATGAAGGG + Intronic
1108310155 13:49181255-49181277 TTTACTCATCACTGGATAAAAGG + Intronic
1108468642 13:50745165-50745187 TTCATTCATCTGTGGACATTTGG - Intronic
1108954078 13:56129309-56129331 TTTACTCATCTTGGAATAAAAGG - Intergenic
1109061278 13:57623548-57623570 TTAATTTATATTTGTATAAATGG + Intergenic
1109301104 13:60591077-60591099 ATAATTCATCTTTGGGGAAAAGG + Intergenic
1109336329 13:60999345-60999367 TTCATTCCTCTTTAGATATTTGG + Intergenic
1110060113 13:71030029-71030051 TTAATTAATCTTTTCATAAATGG + Intergenic
1110298568 13:73898796-73898818 TTTTCTCATTTTTGGATAAATGG - Intronic
1111068192 13:83125524-83125546 ACCATTCATTTTTGGATAAGTGG - Intergenic
1111603726 13:90508462-90508484 TTATTTCTTCTTTGGATAATGGG - Intergenic
1111926183 13:94465207-94465229 TTCATTCATCTTTGTATTCCCGG + Intronic
1112217283 13:97446106-97446128 TACAGTCACCTTTGGAGAAAAGG - Intronic
1112300759 13:98227720-98227742 AACATCCATCCTTGGATAAATGG + Intronic
1112528884 13:100181419-100181441 TTCTTTCTTCTTTGGAAACAGGG + Intronic
1112849707 13:103690367-103690389 TTCAATTATTTTTGGATATATGG + Intergenic
1113045568 13:106151371-106151393 GTCATTCCTCTATGGATAAAAGG + Intergenic
1115346219 14:32345877-32345899 TTCAAGCATCTGTGGATAGAGGG - Intronic
1115507140 14:34103357-34103379 TGCATTAGTCTTTGGATGAAAGG - Intronic
1116463839 14:45210011-45210033 TTTATTCATCTTTTCATTAATGG + Intronic
1116900802 14:50360931-50360953 TCCATTCATCTTTTGATCTATGG + Intronic
1118218937 14:63836992-63837014 TTCTTTCATCTTTGGACACTGGG + Intergenic
1119017679 14:71076304-71076326 TTCATCAATGTTTGGATTAAAGG - Exonic
1119153044 14:72382885-72382907 TTCATGCATATTTGGTTAAATGG + Intronic
1120143430 14:80954666-80954688 CTTATTCCTCTTGGGATAAAAGG - Intronic
1120515019 14:85460312-85460334 TTTCTTCTTCTTTGGAGAAATGG + Intergenic
1121974526 14:98390648-98390670 TACAATCATATTTGGAAAAAGGG - Intergenic
1122358321 14:101137844-101137866 TTCAATCTTATTTGGAGAAAGGG + Intergenic
1123631245 15:22261183-22261205 TTGTTTCATCTTTGGAAAACTGG + Intergenic
1124681934 15:31739363-31739385 TTCATTAATTTTTTGAGAAAGGG - Intronic
1125627582 15:41121285-41121307 TGCATTCAGCTGGGGATAAACGG + Intergenic
1126384633 15:48081449-48081471 TTTAATCATCTTTGGCTACAAGG + Intergenic
1127399573 15:58572767-58572789 TGCATTCATTTTTGGATGCAGGG - Intergenic
1127609946 15:60627069-60627091 TTCATTCCTCTGTGGCTGAAGGG + Intronic
1127678301 15:61266941-61266963 TTCATTTTTGTTTTGATAAAAGG - Intergenic
1128046471 15:64622250-64622272 TTAATACATCTTTGGCTAGAAGG - Intronic
1128198249 15:65779908-65779930 TTTATTTATTTTTGGAGAAATGG + Intronic
1130527215 15:84717444-84717466 TTCATTCATCTTTCCCTAATGGG - Intergenic
1130920711 15:88342206-88342228 TTCATTCATTTTTAGAGACAGGG + Intergenic
1131143534 15:89997443-89997465 CACATTCTTCTTTGGATACAGGG - Intergenic
1131716945 15:95121821-95121843 CTCAGTCATGTTTGGAGAAACGG - Intergenic
1131804909 15:96111124-96111146 TTCATCCATCTTGAGATAATCGG - Intergenic
1131906897 15:97152778-97152800 TTCATTGTTCTTAGGATCAATGG + Intergenic
1133772661 16:8876615-8876637 GTCATTCATCAGTGGATGAATGG - Intergenic
1135543468 16:23350144-23350166 TTCAGTGTTCTTTGGATAATTGG + Intronic
1137890127 16:52151872-52151894 TTCTTTTAACTTTAGATAAATGG - Intergenic
1138854647 16:60674756-60674778 TTCATTCTTTTGTAGATAAAGGG + Intergenic
1139022904 16:62773977-62773999 TTCATCCATGTTTTCATAAATGG + Intergenic
1139144834 16:64310749-64310771 TTCATAAATCTTTGGATAATTGG - Intergenic
1139196958 16:64930658-64930680 TTCATTCATTTTTCCACAAATGG - Intergenic
1140613329 16:76628067-76628089 TTAACTCATTATTGGATAAATGG + Intronic
1140912386 16:79465989-79466011 TTCCTTCATTGTTGAATAAAAGG + Intergenic
1140975366 16:80054992-80055014 GTCATTTATCAATGGATAAATGG + Intergenic
1141971771 16:87489315-87489337 TTGTTTCATCTTTGGAAAACTGG - Intronic
1149672060 17:58423171-58423193 GTCAATCAACTTTGGAAAAATGG - Intronic
1150071083 17:62150593-62150615 TTCACTCATCAATGGAGAAAAGG + Intergenic
1150413882 17:64971162-64971184 TTCATTTTTCTTTTGATACAGGG - Intergenic
1150872341 17:68926862-68926884 TTCATTGCTTTTTGAATAAAGGG + Intronic
1154337452 18:13477006-13477028 TTCAAACATGTTTGTATAAACGG - Intronic
1156088954 18:33441806-33441828 TTTTTTCATCTTTGGCTGAAAGG - Intergenic
1157078209 18:44491894-44491916 ATCATGGATCTTTGGAGAAATGG - Intergenic
1159055033 18:63454768-63454790 TTCCTTCATCCATGGGTAAATGG - Intergenic
1159207094 18:65266828-65266850 CTCATTGTTCTTAGGATAAAGGG - Intergenic
1159352343 18:67292437-67292459 TTCATTGATTTTTTTATAAAAGG - Intergenic
1163285072 19:16341575-16341597 TTCATTCATCAGTGGATACTCGG - Intergenic
1163467486 19:17476767-17476789 TTCATTCATTATTTGACAAATGG + Intronic
1164007108 19:21160469-21160491 TTCATTCACTTTTGGGTAAGAGG - Intronic
1164269610 19:23659993-23660015 GTCATTCATATTTTGATATAAGG + Intronic
1164324351 19:24178965-24178987 TTTATTTATTTTTTGATAAAGGG - Intergenic
1164946358 19:32296439-32296461 TTCATCCATGTTGTGATAAATGG + Intergenic
1166572550 19:43807079-43807101 TTCATTCATCCTTCCATCAATGG + Intronic
1166726204 19:45029374-45029396 TTCATTCATCTCTGTTCAAATGG + Intronic
1167827801 19:51989656-51989678 TAAATTCATCTTTGTATATAGGG - Intergenic
1168424834 19:56231204-56231226 TTCATTTATTTTTTGAGAAAGGG - Intronic
925769046 2:7264739-7264761 TTGAATCTTCTTTGGAAAAATGG - Intergenic
926796610 2:16624878-16624900 TTCCTACCTCTTTGGAAAAATGG - Intronic
927626951 2:24731746-24731768 TCCATTCATCTTTAGATAGAGGG + Intronic
928549973 2:32360645-32360667 TTCAGTCATTTCTGGCTAAAGGG - Intronic
928737088 2:34304237-34304259 TACAGTCAACTTTGAATAAATGG - Intergenic
929036453 2:37697600-37697622 TTCTTTGTTCTTTGGCTAAAAGG + Intronic
929985905 2:46732113-46732135 TTCATTCATCTAGTGTTAAATGG + Intronic
930363174 2:50407599-50407621 TTAATCCATCTGTGGATTAATGG + Intronic
931919506 2:66998063-66998085 TTCATTCTTCTGTGTATATATGG + Intergenic
932170057 2:69546515-69546537 TTCATTCATCTTTGAATATTTGG - Intronic
933606365 2:84388837-84388859 TTCATATATCTTTGGTGAAAAGG - Intergenic
933769708 2:85735197-85735219 TTCATTGATCTCTGGGGAAAGGG - Intergenic
934161701 2:89255769-89255791 ATCAGTAATCTTTGGAGAAATGG + Intergenic
934205583 2:89926646-89926668 ATCAGTAATCTTTGGAGAAATGG - Intergenic
934879191 2:97958695-97958717 TTAATTCAACTTCAGATAAATGG + Intronic
935608220 2:104992052-104992074 ATCGTTCATCATTGGATGAATGG + Intergenic
936077149 2:109408806-109408828 TCCATCCAGCTTTGCATAAAAGG - Intronic
936625581 2:114144837-114144859 TTCATTCATATTTATATAAGAGG + Intergenic
936952365 2:117991038-117991060 TGCATTCATCTTTGGTTATGTGG - Intronic
939089810 2:137766637-137766659 TTTATTCATCTTTTAATAATTGG - Intergenic
939627757 2:144498896-144498918 TTCATTCATTTTTAGAGACAGGG - Intronic
939793064 2:146604940-146604962 TTGACTCATATTTTGATAAAAGG + Intergenic
940555472 2:155221551-155221573 TTCAATCATCATAGGAGAAAAGG + Intergenic
940723337 2:157306085-157306107 TTCCTTAACCTTTGGGTAAATGG + Intronic
941362077 2:164563575-164563597 TACATTTATCTTTCCATAAAAGG + Intronic
941396393 2:164979160-164979182 TTCATTCATGATTGGATTAGGGG - Intergenic
941572249 2:167185881-167185903 TTTATTCATCTGTGACTAAATGG - Intronic
941968837 2:171328195-171328217 TTCACTTATCTCTGGATAGAGGG + Intronic
942656169 2:178216108-178216130 ATCTTTCATCTTTTTATAAAGGG + Intronic
943044967 2:182849422-182849444 TTCTTTCATTTTTTTATAAAAGG + Intronic
943187533 2:184631659-184631681 TTCATTAATCTTTGAAAAAGTGG - Intronic
943793394 2:191961527-191961549 TTCATTTTGCTTTGGAGAAATGG - Intronic
944105428 2:196074559-196074581 GTCTTTCATATTTGGTTAAATGG - Intergenic
944993902 2:205271845-205271867 TTCACTAATCTTGGTATAAAAGG - Intronic
945493814 2:210485669-210485691 TCCATTCATCTGTTGATGAATGG + Intronic
946513828 2:220389795-220389817 CTCATTGATCTGTGGCTAAATGG + Intergenic
946562002 2:220924444-220924466 TTTATTCATTTTTTGAGAAAAGG - Intergenic
946869453 2:224072710-224072732 TTCTTTCCTCTCTGGAGAAATGG + Intergenic
947171053 2:227311738-227311760 TTCATTTATTTATGCATAAAAGG - Intronic
947938235 2:234025738-234025760 TTCACTCATCTCTGAAAAAAAGG - Intergenic
1169099609 20:2935382-2935404 TTCATTCATTGATGGATGAATGG - Intronic
1169627545 20:7589209-7589231 TTGATGCATCTTTGGATTTAAGG - Intergenic
1170260536 20:14401510-14401532 TAGATTCATATTTGGATTAATGG - Intronic
1173419929 20:42892197-42892219 TACATTCAACTGTGAATAAAAGG - Intronic
1174014347 20:47475724-47475746 TTCATTCATTTTTTGAGATAAGG + Intergenic
1174105458 20:48159200-48159222 TTCATTCATTTTTGTTTCAATGG - Intergenic
1175144850 20:56887808-56887830 TTCACTCATGTTTAGGTAAATGG - Intergenic
1176991367 21:15500943-15500965 TTCACTCATCTTTGTCTCAAAGG - Intergenic
1177421342 21:20861730-20861752 TTCTTTCATCTTTTATTAAAAGG - Intergenic
1177875778 21:26629731-26629753 TCCATTCATCCACGGATAAATGG + Intergenic
1179225192 21:39446729-39446751 GACATTCATCTTTGTAAAAATGG + Intronic
1181156396 22:20924179-20924201 TTCATTCATTTTTTGAGACAAGG - Intronic
1182142073 22:27968040-27968062 TTCATTCAACTTTTTATATATGG + Intergenic
1182742080 22:32575193-32575215 TTCATTGTTCATTGGACAAAGGG + Intronic
1183124701 22:35765022-35765044 TTCATTCATCTGAGCATAAGTGG - Intronic
1183635419 22:39059471-39059493 TACTTTCATCTTTGGATACCTGG - Intronic
1185107027 22:48878116-48878138 TTAATTTATCTTTGTTTAAACGG + Intergenic
950197230 3:11017594-11017616 TTCAGGAATCTTTTGATAAAGGG - Intronic
951423894 3:22519538-22519560 ATCATTGATCATTAGATAAATGG + Intergenic
952787356 3:37168283-37168305 TTTAATCATCTTTTGATAGATGG - Intronic
954376631 3:50197612-50197634 TTTATTCATCTATTGATGAATGG + Intergenic
955132112 3:56180414-56180436 TTCATTCATCTATGGACATTTGG - Intronic
956909319 3:73800975-73800997 TTGCTTCATCATTGGTTAAATGG + Intergenic
957701692 3:83723796-83723818 TCCATCCATTTTTGAATAAATGG + Intergenic
957715367 3:83922964-83922986 TATATTGTTCTTTGGATAAATGG + Intergenic
958158710 3:89788969-89788991 TAAATTCATCTTTAGATGAAGGG + Intergenic
958170368 3:89932510-89932532 TACAATTATCTTTGGCTAAAAGG - Intergenic
958877727 3:99634904-99634926 TTCATTTTTCTTTGAATATAGGG - Intergenic
958925985 3:100157592-100157614 TGAATTCCTCTTTGGAAAAATGG - Intronic
960147971 3:114223149-114223171 TCTATTAATCTTTGAATAAATGG + Intergenic
961438878 3:126938945-126938967 TTCATTCTTCTGTGGACAGAAGG + Intronic
961797409 3:129419480-129419502 TTAATTCATTTATGGATTAATGG + Intronic
963205138 3:142625965-142625987 TTCATTCATTTTTTGAGACAGGG - Intronic
963840500 3:150100176-150100198 TCCATTCATCGATGTATAAATGG - Intergenic
966040442 3:175479462-175479484 TTCAATCATCTTGTGAAAAATGG + Intronic
967722873 3:192834028-192834050 TTCATTCATCTTTGAATTGCAGG + Intronic
967795121 3:193591630-193591652 TGCATACATCTTTGCATACATGG + Intronic
970094212 4:12444207-12444229 TTGTTTCAATTTTGGATAAAAGG + Intergenic
970569652 4:17367328-17367350 TTCATCCATCTTTGGACATTTGG - Intergenic
970789047 4:19834903-19834925 TACATTGATTTTTTGATAAAAGG - Intergenic
970979182 4:22076891-22076913 ACCTTGCATCTTTGGATAAAGGG + Intergenic
971748445 4:30614453-30614475 GTCAAGCATCTTTGGAAAAATGG + Intergenic
972020291 4:34304923-34304945 TTCATTCATGCATGGCTAAAAGG + Intergenic
973100590 4:46263771-46263793 TTTGTTCATCTTTGCAAAAAAGG + Intronic
973743145 4:53937498-53937520 TTCATTCATTTTTGTATCATGGG + Intronic
973852084 4:54970800-54970822 TTCATTCACCTTTGAATTTAAGG + Intergenic
973919547 4:55670959-55670981 TAAATTCATGTATGGATAAAAGG + Intergenic
974149025 4:57981788-57981810 TTTCTTCCACTTTGGATAAATGG - Intergenic
974662129 4:64904286-64904308 TTCTTTCTTCTTTGGCTAATAGG + Intergenic
975186300 4:71407595-71407617 AACATTCTTCCTTGGATAAAAGG + Intronic
975812917 4:78188193-78188215 TTCCTTCCTCTGTGGAGAAAAGG + Intronic
976842143 4:89444447-89444469 TTCATTAATTTATGGCTAAATGG + Intergenic
977499816 4:97824324-97824346 TTCATTCAACTTTGAATGAATGG - Intronic
977591353 4:98831207-98831229 TTCATTCATTTTTAGATACAGGG + Intergenic
978147714 4:105395796-105395818 TTCACCCATTTTTGGATATAGGG - Intronic
978629364 4:110725858-110725880 TTCAATCTTCTTTGGGAAAAGGG + Intergenic
979157148 4:117410055-117410077 TTTATTCATATATGTATAAAAGG - Intergenic
979192769 4:117883434-117883456 TAGATTCAACTTTGAATAAAAGG + Intergenic
979798955 4:124882926-124882948 TTCATTCATATTGGGATATTTGG + Intergenic
979847234 4:125531247-125531269 TTCATTCATTTTTTGAAATAAGG + Intergenic
980382097 4:132035334-132035356 TTCATCCATCTTTTCATAAATGG - Intergenic
980382472 4:132041426-132041448 TTAATTCATTTGTGAATAAATGG + Intergenic
981782015 4:148441869-148441891 GAAATTCATCTTTGGGTAAAGGG + Intronic
981903191 4:149890440-149890462 TTCATTCATCCTTTAAAAAATGG + Intergenic
982347854 4:154381006-154381028 AACAATCATCTTTGGAGAAAGGG - Intronic
982445238 4:155483372-155483394 TCCCTTCATCTTTGGAGATAAGG + Intergenic
982616753 4:157647189-157647211 TTTATTTATCTTTTGAGAAAGGG - Intergenic
982645725 4:158022841-158022863 TTTGTTCATATCTGGATAAAAGG - Intergenic
983044682 4:162971909-162971931 TTCAGTCATCTTTACACAAAAGG + Intergenic
983092409 4:163520110-163520132 TTAATTTATCTTTTGACAAAGGG + Exonic
983320151 4:166186737-166186759 TTAATGCAAATTTGGATAAATGG - Intergenic
984037469 4:174687545-174687567 TTCCTTCATCTTTGAGAAAATGG - Intronic
985541254 5:488727-488749 CTCCTTCATCTTTGGGTGAACGG + Intronic
985792866 5:1940109-1940131 TTCATTCATGTTAGCGTAAATGG + Intergenic
985893037 5:2730954-2730976 TTTATTCATTTTTGTAGAAATGG - Intergenic
987609510 5:20183850-20183872 TTCATTCCTCATTAGATATATGG + Intronic
987853634 5:23389541-23389563 TTCATTCATCATTTGAATAATGG + Intergenic
990049534 5:51480328-51480350 TTCATTTTTCTAAGGATAAAAGG + Intergenic
990107519 5:52282723-52282745 TTCATTTATCTTTTGATCCAGGG - Intergenic
990259115 5:54002245-54002267 TTCATTCATCTTTGGATAAAGGG - Intronic
990539960 5:56762737-56762759 TTCCTTAATTTTTGGAAAAATGG - Intergenic
990641936 5:57795514-57795536 TGCATTCAGCTGTGAATAAAAGG - Intergenic
990920927 5:60965669-60965691 TTCATTCATGTTGTCATAAATGG + Intronic
990975495 5:61557123-61557145 TTCATTCATTTTTGAAAATAGGG - Intergenic
991168698 5:63594521-63594543 TTAATTCATTTGTGGATTAATGG + Intergenic
991368500 5:65894124-65894146 TTTATTCATTTTTGGAGACAGGG + Intergenic
991413252 5:66366093-66366115 CTCATTCATTTTTGCATAAAAGG - Intergenic
992430620 5:76707697-76707719 TTTTTTAATCTATGGATAAATGG + Exonic
992818241 5:80466649-80466671 TTCCTATTTCTTTGGATAAAAGG + Intronic
993563845 5:89447661-89447683 TTCATTCCTCTTTAAAAAAATGG + Intergenic
993667326 5:90716253-90716275 CTCAGTAATCTTGGGATAAAAGG - Intronic
993774563 5:91974874-91974896 TTAATTCAGATTTGGATGAATGG - Intergenic
993927918 5:93894620-93894642 TTCATTTATCTTTTCATCAAGGG + Intronic
994374596 5:99004863-99004885 TTCATTCACCTTTTTAGAAATGG + Intergenic
994512918 5:100730394-100730416 TTCATTCTTCTTTAGTTAAATGG - Intergenic
994525059 5:100896288-100896310 TTCATTCATGTTAGCACAAATGG - Intronic
994588662 5:101745553-101745575 TGTATTCATCAGTGGATAAATGG - Intergenic
996074433 5:119173479-119173501 CTCATTCATCTTTGGTCAACTGG + Intronic
996681802 5:126235926-126235948 TTCAACCATCTCTGGTTAAAAGG + Intergenic
997815988 5:137017747-137017769 TTTATTCATCTTTTAATAATTGG - Intronic
997997711 5:138599840-138599862 TTTATTTATTTTTGTATAAATGG - Intergenic
998436426 5:142112973-142112995 TGCGTTCATCTATGGATGAACGG - Intronic
998892312 5:146759337-146759359 TTCAGTAATCTTCAGATAAAAGG - Intronic
1000526468 5:162364677-162364699 TTCATTTAATTTTGGATATAAGG + Intergenic
1001089941 5:168731333-168731355 TGAATTCATCTTTGGATTTATGG - Intronic
1001111739 5:168902225-168902247 TTCGTTAATATTTGGATGAATGG - Intronic
1001302744 5:170548669-170548691 CTCATTCACCTTTGTATTAAAGG + Intronic
1002970931 6:2018721-2018743 TTCATTTATTGATGGATAAATGG - Intronic
1003398284 6:5771514-5771536 ATCAATCATCTTTTGATAAATGG + Intronic
1005610622 6:27520616-27520638 TTCATTCATCTTTCCATTAATGG + Intergenic
1005846043 6:29779522-29779544 TTCATTTATTTTTAGAGAAATGG - Intergenic
1008726320 6:54425242-54425264 TTCATTCATCTATCCATTAAGGG - Intergenic
1008871995 6:56283667-56283689 TTCATTCATCTGTTGGAAAATGG - Intronic
1010011920 6:71057802-71057824 TTCCTTTGTCTTTGGAGAAAGGG + Intergenic
1010235274 6:73569963-73569985 CTCCTTCATCTTTAGATACAGGG + Intergenic
1012353289 6:98280231-98280253 TTCATATATCCTTGGATATATGG + Intergenic
1014446080 6:121529786-121529808 TTAATTCATGTTTGTCTAAATGG - Intergenic
1014549823 6:122777834-122777856 TTTATTTATTTTTGGAGAAAGGG - Intergenic
1015430822 6:133128850-133128872 TTCATTTATCAGTGGATCAAAGG - Intergenic
1015628718 6:135208843-135208865 TTGATTCTTTTTTGGATTAATGG - Intronic
1015772644 6:136784710-136784732 TTCACTCATCCTTGGAGAAATGG + Intronic
1016142421 6:140628974-140628996 TGCATTCATCTTAGGACAATAGG - Intergenic
1017055265 6:150430620-150430642 GTCAATAATGTTTGGATAAAAGG + Intergenic
1017148546 6:151256997-151257019 TTCTTTAATCTTTGGTTAAATGG + Intronic
1018366367 6:163123878-163123900 TTCATTCATCAGTGGACAATTGG + Intronic
1020615120 7:10449801-10449823 TTCATTCATGTTGTCATAAATGG - Intergenic
1021469996 7:20991133-20991155 TTCATACTTCATTGGAGAAAAGG + Intergenic
1021831983 7:24622719-24622741 TTTATTCAACTTTGGATTAGAGG - Intronic
1022217859 7:28281961-28281983 CTCATTCATCTTTGGATCAAGGG + Intergenic
1023725573 7:43139794-43139816 GGCTTTCATCTTTGGAAAAAGGG + Intronic
1023928102 7:44685511-44685533 TTCATTCATCAGTGGATACTTGG + Intronic
1024719049 7:52114067-52114089 TTCATTCATCTTAGAATATGAGG + Intergenic
1026737120 7:72955977-72955999 TTCTTTCATCTTGAGATAAATGG + Intergenic
1027106612 7:75409091-75409113 TTCTTTTATCTTGAGATAAATGG - Intronic
1027353010 7:77330772-77330794 TTCATTAACATTTGGATAAATGG + Intronic
1027675995 7:81159617-81159639 TTCATTCATCTTTGGTTCCCAGG - Intergenic
1028047956 7:86147395-86147417 TTTATTCCACTTAGGATAAATGG - Intergenic
1028658347 7:93236802-93236824 TTCATTTCTGTTTTGATAAAAGG + Intronic
1029531432 7:101127836-101127858 TTCATTCATTTTTAGAGACAGGG - Intronic
1030172996 7:106623626-106623648 TACTTTCATTTTTGTATAAATGG - Intergenic
1030525328 7:110646308-110646330 ATCATTCATGTTTGGAAACAAGG + Intergenic
1030741978 7:113120512-113120534 TTCATACAGCTTGGGAAAAATGG - Intergenic
1031075313 7:117206812-117206834 GTTTTTCATCTTTGGATAACTGG - Intronic
1031443935 7:121827735-121827757 TTCATTCATATTTTCAAAAATGG - Intergenic
1031813674 7:126405458-126405480 TTCATTCATCTTCACGTAAATGG - Intergenic
1031836614 7:126686882-126686904 TTCACATATCTTTGGATAGAAGG - Intronic
1032122253 7:129165545-129165567 TTCATTCACCAGTGGAGAAAAGG + Intronic
1032440917 7:131942444-131942466 TTCATCCATCAATGGATACATGG - Intergenic
1034643258 7:152621729-152621751 ATTATTCATTTTTGGAGAAAGGG + Intergenic
1035415843 7:158685004-158685026 TTCATTCCTCTTTGGAGAGCAGG - Intronic
1036144975 8:6246413-6246435 TTAAAGCATCTTTGAATAAAAGG + Intergenic
1036549908 8:9806656-9806678 TACTTTCATCTTTGGATACCTGG + Intergenic
1037369709 8:18162876-18162898 TTCATTCAGCTGTTGTTAAAGGG - Intergenic
1038684093 8:29700013-29700035 TTCTTTCAATTTTGGCTAAAAGG - Intergenic
1040762778 8:50870669-50870691 TTCATTTATCTTATGATAAAAGG + Intergenic
1042119693 8:65473214-65473236 TTCATTCATCTTTGGTTGTGGGG - Intergenic
1042900670 8:73723856-73723878 TTCATGCTTCTTTGCATACATGG + Intronic
1043131247 8:76464416-76464438 ATCATTCATTTTTATATAAATGG - Intergenic
1043318984 8:78958015-78958037 TTCATGCATGTTTTGACAAATGG - Intergenic
1044307504 8:90654817-90654839 TTATTTCATCTTTCCATAAATGG - Intronic
1044336835 8:90994817-90994839 TAAATATATCTTTGGATAAATGG + Exonic
1045239704 8:100388619-100388641 TTCAATCATTGTTGGAGAAAAGG - Intronic
1045308875 8:100983206-100983228 TTCATTTCTCTTGGGATAAGAGG - Intergenic
1045752874 8:105507344-105507366 TTTCTTCATGTTTGAATAAAAGG - Intronic
1046491506 8:114958325-114958347 TTCATGCATTTTAGTATAAAGGG + Intergenic
1046728246 8:117697478-117697500 TTCATTCATCTTTATGTAACAGG - Intergenic
1047340194 8:123973626-123973648 CTCATTCAACTTTGTATAACTGG - Intronic
1047413809 8:124647145-124647167 GTCATTCCTCTTTAAATAAAAGG + Intronic
1047909285 8:129509819-129509841 ATCAGTCATATTTGAATAAATGG + Intergenic
1049444276 8:142622881-142622903 TTGATTCATTTTTGGACAAAGGG + Intergenic
1050692392 9:8242517-8242539 TTCAATCATTTTTGGAGAACAGG + Intergenic
1051788439 9:20772282-20772304 ATCATACATCGTTGGATATATGG + Intronic
1052266899 9:26584816-26584838 TTCATTCATGTTGTCATAAATGG + Intergenic
1055199923 9:73647248-73647270 TTAATTCGTCTTTGGATATGTGG - Intergenic
1055253542 9:74337895-74337917 TTCATTATTCTTGGAATAAATGG - Intergenic
1056919546 9:90774127-90774149 TTCTTTAATCTTTGGATAAGTGG - Intergenic
1059029211 9:110672209-110672231 TTCATTTACCTTTGGAAATAAGG - Intronic
1062669606 9:137699840-137699862 TTCATTCATTTTTAGAAACAGGG - Intronic
1185667422 X:1777112-1777134 TTCAGTCATTTTTGGAGAACAGG + Intergenic
1185871093 X:3665599-3665621 TTCATTCATCCTTGGACACTGGG - Intronic
1186331331 X:8537542-8537564 TTCTTTCATATTTGGCTAAATGG + Intronic
1186919767 X:14265388-14265410 TTATTTCATCTTTGGAGGAAAGG + Intergenic
1186958666 X:14711065-14711087 TTCACTCATATTTGTATTAATGG - Intronic
1187436978 X:19280222-19280244 TTCATTTTTCTTTGGACATATGG - Intergenic
1187641878 X:21300229-21300251 TGCAATTTTCTTTGGATAAATGG + Intergenic
1187724656 X:22189968-22189990 TTTATTCATCTTTCTTTAAATGG + Intronic
1187751078 X:22465618-22465640 TTAATACATGTATGGATAAAAGG - Intergenic
1188116415 X:26249838-26249860 TTCATTAATCTTTATATAGAAGG + Intergenic
1188695534 X:33185821-33185843 TTCATTAAACATTAGATAAATGG + Intronic
1188796036 X:34466618-34466640 TGCATTCATTTTTGAATAAAAGG + Intergenic
1188864252 X:35295055-35295077 TTCATTCATGTTTTCATAAATGG + Intergenic
1189524600 X:41806755-41806777 TTCCCTCTTCCTTGGATAAAAGG - Intronic
1190476937 X:50837527-50837549 TGCATACATGTTGGGATAAAAGG - Intergenic
1192231509 X:69268312-69268334 TTCCTTCTTCTTTGGGTTAAAGG - Intergenic
1193379623 X:80803406-80803428 ATCATTAATCTTAGGATAACTGG - Intronic
1194020517 X:88685320-88685342 TTCATTCATGTTGTCATAAATGG - Intergenic
1194178260 X:90680091-90680113 TTCATTCATATTTATATGAAGGG - Intergenic
1194646302 X:96462836-96462858 TTCATGCATCTGTGGGGAAAGGG + Intergenic
1196416019 X:115471996-115472018 TTCATCATTCTTTGGATGAATGG - Intergenic
1197143851 X:123148502-123148524 TTGAATCATCTTTGTATAACAGG - Intergenic
1197549338 X:127869365-127869387 TTCATTCATGTTGTTATAAATGG + Intergenic
1197841612 X:130753747-130753769 TCCATTCATCTATTGATACACGG + Intronic
1198425120 X:136510794-136510816 TTCCTCCACCTGTGGATAAATGG - Exonic
1198895239 X:141446864-141446886 CTCACTCATTATTGGATAAATGG - Intergenic
1199211052 X:145210772-145210794 TCCATTCATCTGTGGATAAACGG - Intergenic
1199276807 X:145953835-145953857 TCCATTCATCTTTGGACATTTGG + Intergenic
1200524923 Y:4262251-4262273 TTCATTCATATTTATATGAAGGG - Intergenic
1200792962 Y:7315683-7315705 TTCATTCATCCTTGGACACTGGG + Intergenic
1202081887 Y:21092203-21092225 TTAATTAATCTTTTGACAAATGG + Intergenic