ID: 990259116

View in Genome Browser
Species Human (GRCh38)
Location 5:54002246-54002268
Sequence TTTCATTCATCTTTGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990259116_990259119 9 Left 990259116 5:54002246-54002268 CCTTTATCCAAAGATGAATGAAA 0: 1
1: 0
2: 7
3: 32
4: 383
Right 990259119 5:54002278-54002300 CGTCCTCTAAACATTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
990259116_990259120 10 Left 990259116 5:54002246-54002268 CCTTTATCCAAAGATGAATGAAA 0: 1
1: 0
2: 7
3: 32
4: 383
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259116_990259118 6 Left 990259116 5:54002246-54002268 CCTTTATCCAAAGATGAATGAAA 0: 1
1: 0
2: 7
3: 32
4: 383
Right 990259118 5:54002275-54002297 AGTCGTCCTCTAAACATTAATGG 0: 1
1: 0
2: 0
3: 6
4: 40
990259116_990259122 26 Left 990259116 5:54002246-54002268 CCTTTATCCAAAGATGAATGAAA 0: 1
1: 0
2: 7
3: 32
4: 383
Right 990259122 5:54002295-54002317 TGGAGGGACACAAAACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990259116 Original CRISPR TTTCATTCATCTTTGGATAA AGG (reversed) Intronic
900911700 1:5601189-5601211 TCTCATTCTGCTTTGGATTATGG - Intergenic
905797749 1:40825037-40825059 TTTCAGGCATGTTTGGATAAGGG + Intronic
906027380 1:42684717-42684739 TTTCATTAATTTTTTGATAATGG + Intronic
906174609 1:43760155-43760177 CTTCATTCATCTTTGAGAAAAGG - Intronic
907075453 1:51574046-51574068 TTCCATTCATCTATGAGTAAAGG + Intergenic
910521202 1:88124202-88124224 TCTCATTGCTCTTAGGATAAAGG + Intergenic
910753867 1:90665036-90665058 TTTCAATCAGTTTTGGAAAATGG + Intergenic
911035169 1:93535605-93535627 TTTAATTCATTTTTTGATCATGG + Intronic
911639200 1:100268856-100268878 TTTCACTTAACTTTGGAGAAGGG + Intronic
911867200 1:103044085-103044107 TTTCATTAATCTTCTGATTATGG - Intronic
912401015 1:109392876-109392898 TTCCATTCAGCTTTGGATCAAGG - Intronic
912919501 1:113852533-113852555 ATTAAAGCATCTTTGGATAAAGG + Intronic
914241073 1:145853571-145853593 TCTCATTCATCTGTAGATAAAGG + Exonic
915727289 1:158026813-158026835 TTTCATTCAGCTTTGGAGCATGG - Intronic
917687923 1:177436796-177436818 TTTTGTTCATCTTTGAAAAAAGG + Intergenic
918386826 1:184016941-184016963 TTTCAATCAACTTTGGTTGAGGG - Intronic
918657634 1:187047884-187047906 TTTCCATCATCCTTGAATAAAGG - Intergenic
919273496 1:195382621-195382643 TTTCATTTCTCTTAGGACAAAGG - Intergenic
919287872 1:195588234-195588256 TTTCATATTTCTTTGGCTAAAGG - Intergenic
921786882 1:219242056-219242078 TTTCTTTAACCTTTGGTTAAAGG + Intergenic
922962764 1:229662529-229662551 TTTCATTTTTCTTTGGAGACAGG + Intergenic
923013045 1:230104261-230104283 TTCCATTAACCTTTGGAGAAAGG - Intronic
923432402 1:233935875-233935897 TTTCATTCATCCTCTGCTAAAGG + Intronic
923810629 1:237310608-237310630 TTGAATTCAACTTTGGAGAAAGG + Intronic
924447509 1:244147336-244147358 TTTCTTTAATCTTTTGTTAATGG - Intergenic
1063504920 10:6589048-6589070 ATTCATACAGCTTTGGAAAATGG + Intergenic
1063696639 10:8341915-8341937 TTTCATTGCTCTTAGGATACAGG + Intergenic
1064118355 10:12597769-12597791 GCTCCTTCATCTTTGGATAGAGG - Intronic
1065257375 10:23884646-23884668 TTTCATTCTTCCCTGGATAATGG - Intronic
1065515002 10:26516228-26516250 TCAAATTCATCTTTGGAGAAGGG - Intronic
1065545816 10:26819144-26819166 TTTCATTCATGTTTGCCTTAGGG - Intronic
1065643555 10:27810495-27810517 TTTCATTCGTTTTTGTATGAGGG - Intergenic
1065699064 10:28406929-28406951 ATACAATCATCTTTGCATAATGG + Intergenic
1065820606 10:29521686-29521708 CTTAATTCATCTGTGGTTAAGGG + Intronic
1065947942 10:30624451-30624473 TTCCATTCCTCTTTGGGCAAGGG + Intronic
1066352954 10:34654089-34654111 TTACATTCATGTTTGTATAAAGG - Intronic
1067961603 10:50858328-50858350 TTTCATTCAATTCTGGATACTGG - Intronic
1068819302 10:61354860-61354882 TATCATTCATTTTTAGATCATGG - Intergenic
1068820258 10:61368137-61368159 TTTAATTCATCTATAAATAATGG + Intergenic
1069469103 10:68670428-68670450 TTTCAGCCATCTTTGGCTATAGG - Intronic
1070235532 10:74621608-74621630 TGTCATTCGTATTTTGATAAGGG + Intronic
1071203192 10:83244083-83244105 TTTCATTGATGTTGGGATAGTGG + Intergenic
1071846897 10:89530081-89530103 ATTCACTAATCTTTGGATATTGG + Intronic
1072292621 10:93978228-93978250 TTTCATTCACCTTTGATTCACGG - Intergenic
1073531690 10:104238285-104238307 TTTCATGGCTCTTAGGATAAAGG - Intronic
1073694954 10:105854829-105854851 TTACATTCAACTTTGTATATTGG + Intergenic
1073990049 10:109252409-109252431 ATTAATTCATCTGTGGATACAGG - Intergenic
1074195787 10:111183585-111183607 CTTCATGAATCATTGGATAAAGG + Intergenic
1075134859 10:119775074-119775096 TTTCTCTCTTCTTTGGAAAATGG + Intronic
1075258346 10:120943100-120943122 TGTCTTTCTTCTTTGGCTAATGG - Intergenic
1075278396 10:121116506-121116528 CTACTTTCATCTTTGGATATGGG - Intergenic
1077927997 11:6701099-6701121 TTTTATTCATTTAAGGATAAGGG + Intergenic
1078254758 11:9648663-9648685 ATTCATTCATCCTTGGACATAGG + Intergenic
1078339943 11:10491417-10491439 CTTCATTAATCTTAGGATGAGGG - Intronic
1079734042 11:23973221-23973243 TCAAAATCATCTTTGGATAAAGG - Intergenic
1080625112 11:34022109-34022131 TTTCAGTCATCTTTGGAAAATGG - Intergenic
1080765287 11:35290814-35290836 TTTCCTTCATCTTCGGAAACTGG + Intronic
1080921568 11:36714455-36714477 TGGGATTCATGTTTGGATAAAGG - Intergenic
1081102215 11:39018081-39018103 TTTCATTCACATTTTTATAATGG + Intergenic
1082211211 11:49504398-49504420 TTTCATTCATTTATGGACACGGG - Intergenic
1086014183 11:82145450-82145472 ATTAATTCATCAGTGGATAAAGG - Intergenic
1087369559 11:97265397-97265419 TTTCATTTATCTTGGGAGTAAGG + Intergenic
1087488987 11:98798947-98798969 TTTCTGTCATCTTTGGATTCAGG - Intergenic
1087936387 11:104038200-104038222 TTTCAGTGATCTCTGGACAAGGG - Exonic
1088371497 11:109093190-109093212 TTACATTGTTCTTTGGAGAATGG + Intergenic
1088565538 11:111168424-111168446 ATGCATGCATCTTTGGATCACGG - Intergenic
1088970448 11:114770280-114770302 TGCCATTTATCTTTGGATAATGG + Intergenic
1089823455 11:121249259-121249281 TTTCCTTCGTCTTTGTGTAATGG + Intergenic
1090119633 11:124012563-124012585 TCTCATTCGTCTTTGTATAGTGG - Intergenic
1090149670 11:124369574-124369596 TTGCTTTCTTCTTTGGATACAGG - Intergenic
1091100343 11:132866776-132866798 TTTTACTCATCTTTGAATCAAGG - Intronic
1091267171 11:134280226-134280248 TTGCATTTATCTTGGGATCATGG + Intronic
1092076990 12:5682047-5682069 TTTCCTTCTTCCTTGGCTAAAGG - Intronic
1092085325 12:5753145-5753167 TTAAATTCATCTTTGGAGGAAGG - Intronic
1092085331 12:5753189-5753211 TTAAATTCATCTTTGGAGAAAGG - Intronic
1093415111 12:18910866-18910888 TTTTATACATCTTTGGCTCATGG + Intergenic
1093566939 12:20617930-20617952 TGTCATTCTTCTTTGTAAAATGG + Intronic
1093810305 12:23484714-23484736 TTTCATTTATTTATGTATAAGGG + Intergenic
1094617343 12:32047656-32047678 TTTTATTTATCTTTGCAAAATGG + Intergenic
1095252334 12:39993773-39993795 TTGCATTCATCTGTAGAAAAGGG + Intronic
1095771464 12:45964162-45964184 CTTCATTTCTCTTTGGAAAAGGG + Exonic
1096387315 12:51203491-51203513 TTTCTTTTCTTTTTGGATAAAGG - Intronic
1096611201 12:52803102-52803124 TCTAATTCTTCTTTGTATAATGG + Intergenic
1097280468 12:57842627-57842649 TTTCCCCCATCTTTGGGTAAGGG - Intronic
1097612810 12:61845998-61846020 TTTTATTCAGCTTTGCACAATGG + Intronic
1097695347 12:62769800-62769822 TCAAATTCATCTTTGGAGAAAGG - Intronic
1097698548 12:62798162-62798184 TCAAATTCATCTTTGGAGAAAGG - Intronic
1097996710 12:65895762-65895784 TTGTATGCATATTTGGATAATGG + Intronic
1098432157 12:70431691-70431713 TCTCAATCAACTTTTGATAAAGG - Exonic
1098846239 12:75539018-75539040 TCAAATTCATCTTTGGAGAAAGG + Intergenic
1098849065 12:75572923-75572945 TTCCATTCCTCTTAAGATAAAGG - Intergenic
1098877054 12:75876920-75876942 TTAAAATCATCTTTGGAGAAAGG - Intergenic
1099168141 12:79332538-79332560 TCTCATTCATTTCTGCATAAAGG - Intronic
1099713328 12:86257576-86257598 TTTCATTTATTTCTGAATAATGG + Intronic
1099922979 12:88982092-88982114 TTTCATTCATGCTTAGATCAGGG + Intergenic
1100032797 12:90213855-90213877 TTTCTCTTATCTTTGGATCATGG + Intergenic
1100139108 12:91594497-91594519 TTTAATTTTTCTTTTGATAATGG - Intergenic
1100254357 12:92867349-92867371 TTTCATCCATATTTCCATAATGG + Intronic
1101140678 12:101792520-101792542 TTCGTTTCATCTTTGGACAAGGG - Intronic
1101576628 12:106003297-106003319 TATTCTTCATCTTTGAATAATGG - Intergenic
1101723518 12:107371115-107371137 TTTCATTCCTCTCTGGATCCTGG + Intronic
1103326543 12:120125092-120125114 TTTCAGTTTTCTCTGGATAAGGG + Intergenic
1104216249 12:126736596-126736618 TTCCATTAGTCTTTGGATAAAGG + Intergenic
1104222648 12:126799946-126799968 TTTTAATCCTTTTTGGATAAAGG + Intergenic
1104738882 12:131158144-131158166 TTTCATTCATTTTTGAGTGAGGG + Intergenic
1104779377 12:131410094-131410116 TTTGATTCATGTTTGAATGAAGG - Intergenic
1106029578 13:25987935-25987957 TTACATTCACCTTTGGCTAAAGG + Intronic
1106302056 13:28476264-28476286 TTTCATTCAGCTTAGGCTCAGGG + Intronic
1106783235 13:33080776-33080798 TTTCATTCTGATCTGGATAAAGG + Intergenic
1106849186 13:33770551-33770573 GTCCATTCATCTTTGGAGACAGG - Intergenic
1106925741 13:34611054-34611076 TTTAATTCATCTTTTTCTAAAGG + Intergenic
1107363551 13:39645574-39645596 TGCCATTCATCTTTGAATACCGG - Intergenic
1107442502 13:40440659-40440681 TTTCAATTTTCTGTGGATAAAGG + Intergenic
1107538372 13:41359543-41359565 TTTCACACATATTTGGAAAATGG + Intronic
1108280262 13:48854160-48854182 TTTAATTCATTTTTTGATATGGG - Intergenic
1108615783 13:52130474-52130496 TAGCATTCATCTATGGATACAGG - Intergenic
1108949088 13:56064699-56064721 TTTGATTTATCTTTGGATTAAGG + Intergenic
1109225956 13:59695802-59695824 TGTCATTCTTATTTAGATAAGGG - Intronic
1110506410 13:76292712-76292734 TTTAACTAATGTTTGGATAAGGG + Intergenic
1110985661 13:81964629-81964651 TTTCTTTCTTCTTTGGCTTATGG + Intergenic
1111603727 13:90508463-90508485 TTTATTTCTTCTTTGGATAATGG - Intergenic
1112021697 13:95377301-95377323 TTTTCTTCATCTTTGGTCAATGG - Intergenic
1112528883 13:100181418-100181440 TTTCTTTCTTCTTTGGAAACAGG + Intronic
1112632563 13:101178661-101178683 TTTAATTTTCCTTTGGATAAAGG + Intronic
1114318424 14:21526662-21526684 TCTTATTTTTCTTTGGATAAAGG + Intronic
1114520877 14:23334911-23334933 TTTCAAACATCCATGGATAAAGG - Intergenic
1115271230 14:31555735-31555757 ATTTATTCAGCTTTGGATATGGG + Intronic
1115991140 14:39151562-39151584 TTTCAGTAATTTTTGAATAATGG - Intronic
1116523428 14:45876241-45876263 TTGAAATCATCTTTGGAGAAAGG + Intergenic
1117436767 14:55722660-55722682 TTTCATTGATTATTTGATAATGG - Intergenic
1117568540 14:57021872-57021894 TCTCAAGCATCTTTGGAGAAGGG + Intergenic
1117919134 14:60709427-60709449 TTTTATTTATCTCTGGAAAAGGG - Intergenic
1118218936 14:63836991-63837013 ATTCTTTCATCTTTGGACACTGG + Intergenic
1118516784 14:66538672-66538694 TTTCATTAGCCTATGGATAATGG + Intronic
1121974527 14:98390649-98390671 TTACAATCATATTTGGAAAAAGG - Intergenic
1123539164 15:21270559-21270581 CTTCATTCATGATTGGATTAAGG - Intergenic
1124681935 15:31739364-31739386 TTTCATTAATTTTTTGAGAAAGG - Intronic
1125283522 15:38069009-38069031 ATTCATTCATGTTTGGATTCAGG + Intergenic
1125551257 15:40546646-40546668 GTTGATTCATCTTCTGATAATGG + Intronic
1126844672 15:52747633-52747655 TCAAATTCATCTTTGGAGAAAGG + Intergenic
1127445580 15:59059766-59059788 TTTCTTTCATTTTTGGATAATGG + Intronic
1130369566 15:83273310-83273332 TTTCATTTATCTTTAGATAATGG - Intronic
1130527216 15:84717445-84717467 CTTCATTCATCTTTCCCTAATGG - Intergenic
1131241844 15:90751462-90751484 TTTCACTCATATTTAAATAAGGG - Intronic
1131401720 15:92130732-92130754 TTTCACTCATTTTTGGATGTTGG - Intronic
1131907994 15:97165019-97165041 CTTTATTCAACTTTGGATTATGG + Intergenic
1132127671 15:99242777-99242799 TTTTAATCATGATTGGATAATGG - Intronic
1135279951 16:21145774-21145796 TCTAATTCACCTTTGGACAATGG + Intronic
1135376118 16:21948802-21948824 TTGAAATCATCTTTGGAGAAAGG - Intergenic
1137532693 16:49291191-49291213 CTTGTTTCATCTATGGATAATGG - Intergenic
1138772653 16:59684311-59684333 TTTGATTCATGTTTGTATCAGGG + Intergenic
1138813420 16:60177180-60177202 TTTCATCAGTCTTTGGTTAAAGG + Intergenic
1140963781 16:79944115-79944137 TTTCATTCATCCTTGGTTGAGGG - Intergenic
1143528128 17:7484073-7484095 TTTCATTCTAGTTTGGACAACGG - Exonic
1144395426 17:14838388-14838410 TTTCATTCATCATTAGATCCAGG - Intergenic
1144416416 17:15051781-15051803 TTTGATTCATCTTTGCAAGATGG + Intergenic
1146726428 17:35160052-35160074 TTAAAATCATCTTTGGAGAAAGG - Intronic
1147910115 17:43850795-43850817 TTTTATTCATCTTTGCCTGAAGG + Intronic
1150413883 17:64971163-64971185 TTTCATTTTTCTTTTGATACAGG - Intergenic
1150892848 17:69174320-69174342 TTTCATTCATCTTTCGCAAGTGG - Exonic
1155056949 18:22193441-22193463 TTTAATTCCTCTTTGGAGGAAGG + Intronic
1155832207 18:30532154-30532176 TTTCATTTAGCTTTGGAATATGG - Intergenic
1156393347 18:36673933-36673955 TATTATTCAAGTTTGGATAATGG + Intronic
1156787067 18:40928201-40928223 TTTATTTCAGCCTTGGATAAAGG + Intergenic
1158419553 18:57280648-57280670 TTTCAGTCAGCTCTGGAAAAAGG - Intergenic
1158433696 18:57417303-57417325 TCTCATTCATCTTTGTAACATGG + Intergenic
1158465094 18:57682764-57682786 TTAGATTCATCCTTGGAAAATGG + Intronic
1159207095 18:65266829-65266851 TCTCATTGTTCTTAGGATAAAGG - Intergenic
1159290947 18:66418933-66418955 TTTCACAGTTCTTTGGATAATGG - Intergenic
1159328949 18:66963183-66963205 TTTAATTCATCTGAAGATAATGG + Intergenic
1159331996 18:67007021-67007043 TGTCATTTATATTTTGATAAGGG + Intergenic
1159576927 18:70190657-70190679 GTTCATTCACCTTTGGATATGGG - Exonic
1159763552 18:72458176-72458198 TTTCATTCAGCTTTCTGTAAAGG - Intergenic
1159998390 18:74990976-74990998 TTTCATCCATCTTTGTTGAATGG - Intronic
1160067776 18:75593430-75593452 TTTTTTTCATCTTTGGCTACTGG + Intergenic
1161867260 19:6842290-6842312 TTTCATCCATATTTAGATGAGGG + Intronic
1164872436 19:31657094-31657116 GTTCATTCATCTATGGAATAAGG - Intergenic
1167827802 19:51989657-51989679 TTAAATTCATCTTTGTATATAGG - Intergenic
1168025485 19:53640639-53640661 TTCCAAGCATCTTTGGAGAAGGG + Intergenic
925206073 2:2007454-2007476 TCAAATTCATCTTTGGAGAAAGG - Intronic
926227053 2:10974142-10974164 TTTCATTCATAGTTTGATGAAGG - Intergenic
927626950 2:24731745-24731767 TTCCATTCATCTTTAGATAGAGG + Intronic
928807476 2:35177211-35177233 TTTAATTTATCAGTGGATAAGGG - Intergenic
929335308 2:40736467-40736489 TTTTATTCTCCTTTGGAGAATGG - Intergenic
930401735 2:50898382-50898404 TCTTATACATCTTTGGAAAAGGG - Intronic
931031658 2:58182127-58182149 TTTCCTTCAACTATGGATATAGG + Intronic
931617385 2:64173853-64173875 CTTCATTCTTTTTGGGATAAAGG + Intergenic
932081162 2:68716292-68716314 TTTCTTTCTTCTTTTGAAAAGGG - Intronic
937176387 2:119940015-119940037 TACCATTCATCTCTGGCTAAAGG + Intronic
937646434 2:124270520-124270542 TTTCATGCATGTTTGGAGACGGG + Intronic
937704392 2:124902506-124902528 CATCATTTATCTTTGGATACTGG - Intronic
938057779 2:128230087-128230109 TTTCATTCAGCACTGGAAAATGG + Intergenic
938876270 2:135533966-135533988 TTTCATGCATATTTAGAGAATGG + Intronic
939254367 2:139723312-139723334 TCAGATTCATCTTTGGAGAAAGG + Intergenic
939254937 2:139730630-139730652 TTAAATTCATATTTGGAGAAAGG + Intergenic
939761515 2:146187795-146187817 TTTCATGCCTCTTTTGATATAGG - Intergenic
941384069 2:164831864-164831886 TTGCATTCATCTTAGCACAAAGG + Intronic
941396394 2:164979161-164979183 CTTCATTCATGATTGGATTAGGG - Intergenic
941501191 2:166279182-166279204 TTCTATTTATCTTTGGAAAAAGG - Intronic
941510823 2:166407038-166407060 TGTCATTCATCTTTGTATATTGG - Intronic
942481701 2:176394921-176394943 TCTCATTCATCTTTGCATAGAGG + Intergenic
942664497 2:178303158-178303180 TTTCATTCATTATTGGCAAAAGG - Intronic
942820538 2:180108799-180108821 TTTCATTCCTCTTTGTATGAGGG + Intergenic
943348131 2:186764956-186764978 TTTTATTCATTTTTGTGTAAGGG + Exonic
943380852 2:187145018-187145040 TTTCCTTCACTTTTGAATAACGG - Intergenic
943990323 2:194681679-194681701 TTTCCTTTATCTTTTCATAAAGG + Intergenic
945673503 2:212830570-212830592 TTTCCTTCTTCCTTGGATATGGG - Intergenic
946428185 2:219610908-219610930 TTTCTTTCTTCTTTGCAAAATGG + Intronic
946430859 2:219626930-219626952 TTTCATTGATCTCGGGATAGGGG + Intergenic
1169271906 20:4206742-4206764 TTAAATTCATCTTTAGAGAAAGG + Intergenic
1169457364 20:5763657-5763679 TCAAATTCATCTTTGGAAAAAGG + Intronic
1169604525 20:7301782-7301804 TTTCATTCAAATTTGGCAAAAGG - Intergenic
1170422509 20:16206925-16206947 TTACTTTCATCATTGGTTAAAGG + Intergenic
1170970189 20:21108628-21108650 TTGCACTCATCTTTGGCTCAGGG - Intergenic
1173270938 20:41534274-41534296 TTACAATCATCTTTGCATGATGG + Intronic
1173552678 20:43944072-43944094 TTTCATCCATCTTTGTATCGCGG + Intronic
1174917928 20:54672631-54672653 TTTCTTCCTTCTCTGGATAAAGG + Intergenic
1175002359 20:55643042-55643064 TTTCACTCATCTGTGGACCATGG - Intergenic
1175703226 20:61155643-61155665 TGACATTCATCTTTGGAAGATGG - Intergenic
1177172461 21:17669442-17669464 TTTCAATCATGTTTGGACATGGG + Intergenic
1178686098 21:34711828-34711850 TTTCATTAAATTTTGGATATTGG - Intronic
1179364860 21:40749644-40749666 TTTCATGCCTCTTTCCATAATGG - Intronic
1179393263 21:41013328-41013350 TTTCATTTATCTAGGGATAATGG - Intergenic
1182193778 22:28492799-28492821 TTTTGTTCATTTTTGGAGAAAGG - Intronic
1182742079 22:32575192-32575214 TTTCATTGTTCATTGGACAAAGG + Intronic
1182763365 22:32740866-32740888 TTTGATCCTTCTTTGGATACTGG - Intronic
949194834 3:1292400-1292422 TTTAATTCCTCTTTCAATAATGG + Intronic
949591006 3:5494069-5494091 TCTAATTGATCATTGGATAATGG - Intergenic
949621010 3:5811610-5811632 TTCCATCAATCCTTGGATAAGGG - Intergenic
949972059 3:9416366-9416388 TGTCATTCATTTTTGTATATTGG + Intronic
950514365 3:13454569-13454591 TTTCATTCATCTTCTGGAAAGGG + Intergenic
952089352 3:29865389-29865411 TTTTATACGTCTTTGGGTAATGG - Intronic
952110826 3:30122484-30122506 TTTCACTCATCTTTGGGAGAAGG - Intergenic
952739652 3:36723369-36723391 TTTAATTTATCCTTGGAAAATGG - Intronic
953225738 3:41018036-41018058 TTTCATTCTTATTTGGAGAGAGG + Intergenic
954063845 3:48090259-48090281 TCAAATTCATCTTTGGAGAAAGG - Intergenic
954846461 3:53562920-53562942 TTCCATTCAGCCTTGTATAAAGG - Intronic
954989169 3:54824499-54824521 TTGCATTCATCATTGCAGAAGGG + Intronic
955035705 3:55265166-55265188 TTTCTATCATCTCTGGAGAAAGG + Intergenic
955177100 3:56627260-56627282 TTTCATTTCTCTTTGTCTAAGGG + Intronic
956555586 3:70519082-70519104 ATTCAATCATCTTTGGACAAAGG - Intergenic
957814709 3:85280910-85280932 TTTACTTCATCTTTGGCTAATGG - Intronic
958000609 3:87744111-87744133 TTTCTTCCATCTTTGGATAATGG - Intergenic
958468606 3:94489457-94489479 TTCCATGCATCTATGGGTAATGG - Intergenic
958677039 3:97278384-97278406 GTTCTTTCATTTTTGCATAAAGG + Intronic
958877728 3:99634905-99634927 TTTCATTTTTCTTTGAATATAGG - Intergenic
959103188 3:102037327-102037349 CTTCATTCTTCTTTTGAAAACGG + Intergenic
959882574 3:111461672-111461694 CTTCATTCTCCTTTGGATGAGGG - Intronic
959941977 3:112089819-112089841 TTACATCCGTCTTTAGATAAAGG - Intronic
960235395 3:115275962-115275984 ATTTATTCAGCTATGGATAAAGG + Intergenic
961903059 3:130233425-130233447 TTAATTTCATCTTTGGATCAGGG + Intergenic
962703795 3:138024357-138024379 TTTCATGCATCTTGGGACCAAGG - Intronic
963591298 3:147262899-147262921 TCTCATTCATCTTAAGATAGAGG - Intergenic
963855029 3:150244579-150244601 TTTGATTGCTCTTTGGAGAATGG + Intergenic
964293457 3:155207943-155207965 CCTCAATCATCTTTGGAGAAAGG - Intergenic
965765726 3:172128202-172128224 TTTCAATCAGCTTTGGATTCAGG + Intronic
965830093 3:172776415-172776437 TTTTAGACATTTTTGGATAATGG - Intronic
967357562 3:188589364-188589386 TTTCATTTTTCTTTAAATAAAGG - Intronic
967381310 3:188861996-188862018 CTTCATTCAGCTTTGGCCAAAGG + Intronic
967492316 3:190107702-190107724 TTACATTTAGCTTTGGGTAATGG + Intronic
968415299 4:427256-427278 TTTCATTCATCTTTTGCAAGTGG - Intronic
970459979 4:16264750-16264772 CTTCATTAATATTTAGATAAAGG - Intergenic
970836768 4:20418411-20418433 TTTCTTTCAGCTATGTATAATGG - Intronic
971018784 4:22514541-22514563 TTGCATTCATGTTTGTATAGTGG + Intronic
971642823 4:29157643-29157665 TTCCATTCATGTTTGAATACAGG - Intergenic
973743144 4:53937497-53937519 TTTCATTCATTTTTGTATCATGG + Intronic
973756110 4:54075101-54075123 TTTTATTCATTTTTGGAGACTGG - Intronic
974292695 4:59953777-59953799 TATCATTAATATTTTGATAATGG - Intergenic
974293424 4:59963639-59963661 TTTCATTCTTATTGGGACAAGGG + Intergenic
974369946 4:61002920-61002942 ATTCATTCTGCTTTGCATAATGG - Intergenic
974583590 4:63838942-63838964 TTCCAGACATCTTTGGATCAAGG + Intergenic
974698963 4:65413489-65413511 TTTCATTGATTTTTGAAAAAAGG + Intronic
975383033 4:73724574-73724596 TTTCATTCATGTTTTTAAAAGGG - Intergenic
976587752 4:86817935-86817957 TCAAATTCATCTTTGGAGAAAGG - Intergenic
977104427 4:92863148-92863170 TTTCATTTATCTTTTGATTTAGG + Intronic
977591352 4:98831206-98831228 ATTCATTCATTTTTAGATACAGG + Intergenic
978348309 4:107795193-107795215 TTTCATTAAACTCTGGAGAATGG + Intergenic
978629363 4:110725857-110725879 TTTCAATCTTCTTTGGGAAAAGG + Intergenic
978841785 4:113222805-113222827 TTTTAATCATCTTTGGAGAGAGG + Intronic
979455797 4:120924030-120924052 TTTGATTCAAGTTTGGAAAAAGG + Intergenic
979860472 4:125687017-125687039 GTTCATTCATGTTTCTATAAAGG + Intergenic
980820884 4:138015476-138015498 TAACATTCATCTTTGAATACTGG - Intergenic
981764590 4:148234044-148234066 TTTCAATGATCTTTAGATATAGG - Intronic
982616754 4:157647190-157647212 TTTTATTTATCTTTTGAGAAAGG - Intergenic
983115064 4:163804999-163805021 TTTTTTTCATCTTTGGATAATGG + Intronic
983422725 4:167540459-167540481 TTTCCTTCATTTTTGAAGAATGG + Intergenic
983763450 4:171444552-171444574 TTTTCTTAATCTTTGAATAATGG + Intergenic
983979612 4:173978056-173978078 TTCCTTACATCTTTGGATGAAGG - Intergenic
984056061 4:174930395-174930417 GTTCATTCATCTTGTGAAAAAGG + Intronic
984493086 4:180460359-180460381 TTTCAGTGATTTTTGCATAAAGG - Intergenic
986031343 5:3895744-3895766 TTCCATTCATATGTGGATTATGG + Intergenic
986262356 5:6159540-6159562 TCTCTTTAATCTTTGGAGAATGG - Intergenic
988795965 5:34654100-34654122 TTACCTTGATATTTGGATAAAGG + Intergenic
990107520 5:52282724-52282746 TTTCATTTATCTTTTGATCCAGG - Intergenic
990259116 5:54002246-54002268 TTTCATTCATCTTTGGATAAAGG - Intronic
991372647 5:65935729-65935751 TTTTATTCTTTTTTGGAGAAGGG + Intronic
991710628 5:69405088-69405110 TATCATTTATCTTTTGGTAACGG - Intronic
991996999 5:72397913-72397935 TCAAATTCATCTTTGGAGAAAGG - Intergenic
992250113 5:74867659-74867681 TTTCATTCATCACTGGCTATGGG - Intergenic
994447951 5:99901759-99901781 ATTCATAGATCTGTGGATAAAGG - Intergenic
994629044 5:102258992-102259014 TTTCATTTATCTTTGATTACAGG - Intronic
994972111 5:106754098-106754120 TTTTATTCATCTTTGTATCTGGG - Intergenic
995431665 5:112086097-112086119 TTTCTTTTATTTTTTGATAAGGG + Intergenic
996007102 5:118434611-118434633 TTTCTTCCATCTTCTGATAAAGG + Intergenic
996921820 5:128776987-128777009 TCTCATTTCTCTTAGGATAAGGG - Intronic
998556178 5:143126013-143126035 TTTTACTTATCTTTGGCTAATGG - Intronic
1000177931 5:158776592-158776614 TGTCAGTCATCCTTGGATAGTGG - Intronic
1000583620 5:163065777-163065799 GTTCCTCCATCTTTGGAGAAAGG - Intergenic
1001214681 5:169844686-169844708 TATCATTCATCATTGGGGAAAGG - Intronic
1001492137 5:172163406-172163428 TGTCATTCATCTTTAGCAAAGGG - Intronic
1003568465 6:7240236-7240258 TTCCATTCAACTTAGGAAAAGGG + Intronic
1003603320 6:7538747-7538769 TTTCATTTATCTTTCTCTAAGGG - Intergenic
1003986429 6:11440413-11440435 TTTCCTTCATGTTTGGAGAAAGG + Intergenic
1004559081 6:16729926-16729948 TTTCATTCATTTGGGGAAAAAGG - Intronic
1004796323 6:19089772-19089794 TTCCCTTGATCTTAGGATAAAGG - Intergenic
1005718241 6:28573982-28574004 TTTTATACATCTTTGGGTTATGG + Intronic
1008043457 6:46827654-46827676 TTTCCTCCATCTTTGGAAGAGGG + Intronic
1008076649 6:47152761-47152783 TTTCTTTCATCTTTGGATATGGG + Intergenic
1008090358 6:47287410-47287432 TTTTATTCATTTAAGGATAAGGG + Intronic
1008646873 6:53523348-53523370 TTTCACTTATATATGGATAATGG - Intronic
1008939164 6:57027746-57027768 TTTTATTCATCTTTGTAAATTGG + Intergenic
1009299583 6:61997819-61997841 TGTCATTGATCTTTGGAGAATGG - Intronic
1010172345 6:72988346-72988368 TTTCATCCATGTTGGGACAAAGG - Intronic
1010235273 6:73569962-73569984 TCTCCTTCATCTTTAGATACAGG + Intergenic
1010600155 6:77814813-77814835 TTAAAGTCATCTTTGGAGAAAGG + Intronic
1010682416 6:78812052-78812074 TTTCAATAATCTTTGAACAAGGG + Intergenic
1010938687 6:81890048-81890070 CATAATTCATCTTTGGATGAAGG - Intergenic
1011122521 6:83969265-83969287 TTAAATTCATCTTTGGAGAAAGG - Intergenic
1011286564 6:85730921-85730943 TCACAATCATCTTTGGAGAAAGG - Intergenic
1011982159 6:93393068-93393090 TTGCAATCAACTTTGAATAAGGG + Intronic
1012325836 6:97915956-97915978 TTCCTTTCATTTTTGGAGAAGGG - Intergenic
1014085487 6:117337976-117337998 TTTCATTCCACTTTAGATATTGG + Intronic
1014619398 6:123646881-123646903 GTTAATTCATCTCTGGATAATGG + Intergenic
1014683676 6:124467411-124467433 TTTCTTTCATTTTCAGATAATGG - Intronic
1015262176 6:131250589-131250611 TTTCCTTCATCTCTTGAGAAAGG - Intronic
1015821090 6:137260940-137260962 TTAAAATCATCTTTGGAGAAAGG + Intergenic
1016933522 6:149431300-149431322 TCTCTTTCATCTTTGCATATGGG - Intergenic
1018964870 6:168477017-168477039 TTTCGTCCAGCTTTGGTTAAAGG - Intronic
1019162373 6:170077093-170077115 TTTTATGCATTTTTGGATTATGG - Intergenic
1019761479 7:2815883-2815905 TTTCATTCATCTGAAAATAAGGG + Intronic
1020671103 7:11113611-11113633 TTTCATTTTTCATTGGAAAATGG - Intronic
1021245369 7:18255371-18255393 TTTCATTGATTCTTGGAGAATGG + Intronic
1022088410 7:27091138-27091160 TTCCATCCCTCTTTGGAAAAGGG - Intergenic
1022217858 7:28281960-28281982 TCTCATTCATCTTTGGATCAAGG + Intergenic
1023191767 7:37590808-37590830 TCAAATTCATCTTTGGAGAAAGG - Intergenic
1023227692 7:37988428-37988450 GTTCATCCATTTTAGGATAAAGG - Intronic
1025135791 7:56411421-56411443 TTTCTTTCATCATTATATAAAGG + Intergenic
1025989814 7:66488890-66488912 TTTCTTTCATCATTATATAAAGG + Intergenic
1026038928 7:66849784-66849806 TTTCTTTCATCATTATATAAAGG - Intergenic
1027212439 7:76161739-76161761 TTTCTTTCATCATTATATAAAGG + Intergenic
1027481019 7:78696521-78696543 TGTCCTTCATCTGTGGATGAAGG - Intronic
1027678703 7:81191365-81191387 TTTGTTTCATTTTTGGATAAAGG - Intronic
1029531433 7:101127837-101127859 TTTCATTCATTTTTAGAGACAGG - Intronic
1030131419 7:106204965-106204987 TTGCTTTCATAATTGGATAAAGG + Intergenic
1030428118 7:109406427-109406449 TTTCATTCTACTTGGGATTAGGG - Intergenic
1030651530 7:112121019-112121041 TCTCAGTCATCTTAGCATAAAGG + Intronic
1031345119 7:120655753-120655775 TTTCAATCATTTTTGGGTGAGGG - Intronic
1031707542 7:124999577-124999599 TTTCATTCATCTCTGGGTCAGGG + Intergenic
1031710302 7:125036494-125036516 TTCAATTCATATATGGATAAAGG - Intergenic
1032047891 7:128624720-128624742 TTTCTTTCATCATTATATAAAGG - Intergenic
1033096172 7:138433350-138433372 TCTCATTCATCTTAGTTTAATGG - Intergenic
1034407814 7:150916941-150916963 TTCCATTAGTCTTTGGATATGGG - Intergenic
1034881901 7:154769172-154769194 TTTGATTGAGCTTTGGTTAATGG + Intronic
1036057065 8:5267334-5267356 TTTCATGCATATTTGGATAGAGG + Intergenic
1039106595 8:33996402-33996424 TTTCTGTCTTCTTTGGACAATGG + Intergenic
1040035053 8:42861959-42861981 TTTCACTCATTTTTAAATAAAGG + Intronic
1041029855 8:53725569-53725591 TTCCACTCATCTTTGTGTAAGGG - Intronic
1041305555 8:56454380-56454402 TTCCATTCATCTTTCTATTATGG - Intergenic
1041660233 8:60394116-60394138 TTTCACCCATCTTTGCAAAAAGG + Intergenic
1041813988 8:61946281-61946303 TTTTATATATCTTTGGCTAAGGG + Intergenic
1042119694 8:65473215-65473237 ATTCATTCATCTTTGGTTGTGGG - Intergenic
1043386400 8:79752224-79752246 TTTCATTTTTCTTTGGAGAGGGG - Intergenic
1043566822 8:81558330-81558352 GTTCATTCATCCTTAGGTAACGG + Intergenic
1045810958 8:106219446-106219468 TTTCAGTTTGCTTTGGATAATGG + Intergenic
1045909985 8:107396290-107396312 TTTCATTCATCTGTGCATTTTGG + Intronic
1047079783 8:121446745-121446767 TCTCATTGGTCTTAGGATAATGG - Intergenic
1047513851 8:125536598-125536620 ATTAATTCATCTGTGAATAAAGG + Intergenic
1047654530 8:126962334-126962356 TTCCATTGGTTTTTGGATAATGG + Intergenic
1048795268 8:138143759-138143781 TTTCAAACATTTTTGGATATTGG - Intronic
1049444275 8:142622880-142622902 TTTGATTCATTTTTGGACAAAGG + Intergenic
1049566455 8:143341578-143341600 TTTAACTCAGCTTTGGAAAATGG + Intronic
1049874158 8:145004398-145004420 TTTATTTTAACTTTGGATAAAGG + Intergenic
1050297577 9:4221487-4221509 TTCCATTCATCTAAGGAGAATGG - Intronic
1050442037 9:5674797-5674819 TCAAATTCATCTTTGGAGAAAGG + Intronic
1052203395 9:25809419-25809441 TTCTATTTATCTTTGGTTAAAGG + Intergenic
1052912299 9:33894441-33894463 TTTCATTTATTTTTGGGGAATGG + Intronic
1053510041 9:38679960-38679982 TTTGACTCATCTTTGGATTTTGG - Intergenic
1055217377 9:73882901-73882923 TTTATCTCATCTTTGGAAAACGG + Intergenic
1055413615 9:76058566-76058588 TTTAAATCTTCTTTGGATCAAGG + Intronic
1055875323 9:80935121-80935143 TTTCATTCATCTTTCCCTTATGG + Intergenic
1057101817 9:92368374-92368396 TACCAATCATTTTTGGATAAGGG + Intronic
1058232171 9:102440188-102440210 TTTTATTCTTCTATGGAGAAGGG + Intergenic
1060568854 9:124619105-124619127 TTTCATTCATCTTTTGTTGGTGG - Intronic
1185871094 X:3665600-3665622 ATTCATTCATCCTTGGACACTGG - Intronic
1186926803 X:14342641-14342663 GGCCATTCATCTCTGGATAATGG - Intergenic
1187264873 X:17722028-17722050 TTTCATGCTTCCTTGGATGAAGG + Intronic
1187362213 X:18639365-18639387 ATTTGTACATCTTTGGATAAAGG - Intronic
1187401930 X:18967798-18967820 TTTCTTTCTTCTTTTAATAAAGG - Intronic
1187988610 X:24843997-24844019 TTGCTTAGATCTTTGGATAAAGG + Intronic
1188749657 X:33889371-33889393 TCTCATTCATCTTTGCATGAAGG + Intergenic
1188939925 X:36224972-36224994 TTTCATTTAACTTTGGTTATTGG - Intergenic
1190105750 X:47560207-47560229 TTTCGTTTTCCTTTGGATAAAGG - Intergenic
1191954618 X:66630666-66630688 TTTTATTTATTTTTGGATTATGG - Intronic
1193278249 X:79616961-79616983 TTTCATTCAATTATGGATATTGG - Intergenic
1193747654 X:85301399-85301421 TTTCCTTCATTTTTGAAGAATGG - Intronic
1194178261 X:90680092-90680114 TTTCATTCATATTTATATGAAGG - Intergenic
1194486359 X:94491891-94491913 ATTCATTCATCCTTGGGTCAGGG + Intergenic
1194502283 X:94696540-94696562 TCAAATTCATCTTTGGAGAAAGG + Intergenic
1194646301 X:96462835-96462857 TTTCATGCATCTGTGGGGAAAGG + Intergenic
1196377476 X:115049762-115049784 TTTCATGCATTTATGGAGAAAGG - Intergenic
1196382560 X:115107970-115107992 TTTGAATTATCTTTAGATAATGG - Intergenic
1197526041 X:127564591-127564613 ATTCATTAATCTTTGGATTTTGG - Intergenic
1197626659 X:128809636-128809658 TTCCTTTCCTATTTGGATAAGGG + Intergenic
1197945645 X:131836189-131836211 CTTCATTCAACATTGAATAATGG + Intergenic
1199381345 X:147176273-147176295 CTCAATTCATCTTTGGAGAAAGG - Intergenic
1199905756 X:152227870-152227892 TTCCATTCATCTGAGGGTAACGG + Intronic
1200051412 X:153433747-153433769 TTTCATTTTCCTTTGGATACAGG + Intergenic
1200524924 Y:4262252-4262274 TTTCATTCATATTTATATGAAGG - Intergenic
1200792961 Y:7315682-7315704 ATTCATTCATCCTTGGACACTGG + Intergenic
1200836797 Y:7740170-7740192 TTTAAGTCATCTCTGGAGAATGG - Intergenic
1201613212 Y:15866108-15866130 TTCAAATCATCTTTGGAGAAAGG + Intergenic
1202069377 Y:20974793-20974815 ATTCATACATCGTTGGATCAGGG + Intergenic
1202147555 Y:21815913-21815935 TTTGATATATATTTGGATAAGGG + Intergenic