ID: 990259117

View in Genome Browser
Species Human (GRCh38)
Location 5:54002253-54002275
Sequence TGATGTCTTTCATTCATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 507}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990259117_990259118 -1 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259118 5:54002275-54002297 AGTCGTCCTCTAAACATTAATGG 0: 1
1: 0
2: 0
3: 6
4: 40
990259117_990259120 3 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259117_990259119 2 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259119 5:54002278-54002300 CGTCCTCTAAACATTAATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
990259117_990259122 19 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259122 5:54002295-54002317 TGGAGGGACACAAAACCAAAAGG No data
990259117_990259123 25 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259123 5:54002301-54002323 GACACAAAACCAAAAGGCAATGG 0: 1
1: 0
2: 4
3: 44
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990259117 Original CRISPR TGATGTCTTTCATTCATCTT TGG (reversed) Intronic
901273936 1:7975626-7975648 TGATGTCTTTCATACTTATCAGG - Intronic
901950035 1:12737131-12737153 AAATGTCTTTCAATCATTTTAGG - Intergenic
904315807 1:29662009-29662031 TCATGTCTTTCATTAAATTTAGG + Intergenic
906017711 1:42597275-42597297 TGGTGTCTGTCATTAATCTCAGG - Intronic
906031313 1:42722585-42722607 TCATGTCTTTCATTAAATTTGGG - Intergenic
907037810 1:51232058-51232080 TGATGGCTATTATTCAACTTGGG + Intergenic
907634703 1:56122337-56122359 TTAAGTCTTTAATCCATCTTGGG + Intergenic
909708231 1:78612567-78612589 TTAAGTCTTTAATCCATCTTGGG - Intergenic
909946188 1:81666218-81666240 TGGTCTCTTTCAGTCATCTATGG - Intronic
910148172 1:84107334-84107356 TTAGGTCTTTAATTCATTTTGGG - Intronic
910781936 1:90947746-90947768 TGATGTTTTCCATTTATCATGGG - Intronic
911622877 1:100086844-100086866 TGATATATTTAATTCATCATAGG - Intronic
911763871 1:101649735-101649757 TGATGTCTTTCTTTCCAATTTGG + Intergenic
911772402 1:101763022-101763044 TTATTTCTTTCATTTATGTTTGG + Intergenic
911896737 1:103445583-103445605 TTAGGTCTTTAATTCATCTTTGG - Intergenic
912765721 1:112408403-112408425 TGGTCCCTTTCATTCCTCTTTGG - Intronic
913443422 1:118924178-118924200 TGATGTTATTAATTTATCTTTGG - Intronic
913578499 1:120201639-120201661 ACATGTCTTTCATTTCTCTTGGG + Intergenic
913629673 1:120696712-120696734 ACATGTCTTTCATTTCTCTTGGG - Intergenic
913684152 1:121215543-121215565 TTATCTCTTTCATTCATTTTGGG + Intronic
914035991 1:144003158-144003180 TTATCTCTTTCATTCATTTTGGG + Intergenic
914153467 1:145064787-145064809 TTATCTCTTTCATTCATTTTGGG - Intronic
914560423 1:148813079-148813101 ACATGTCTTTCATTTCTCTTGGG + Intronic
914612410 1:149317136-149317158 ACATGTCTTTCATTTCTCTTGGG - Intergenic
914945506 1:152061881-152061903 TGATGTCTCTCATACTTCCTGGG + Intergenic
915683896 1:157610955-157610977 TTAAGTCTTTGATCCATCTTGGG - Intergenic
915727290 1:158026820-158026842 TGCTTTTTTTCATTCAGCTTTGG - Intronic
915833153 1:159149860-159149882 TTAAGTCTTTAATCCATCTTGGG + Intergenic
916973911 1:170053841-170053863 TTAAGTCTTTAATCCATCTTGGG - Intronic
917158503 1:172030405-172030427 TTAAGTCTTTAATCCATCTTGGG - Intronic
917272508 1:173293466-173293488 TTAAGTCTTTAATTTATCTTGGG - Intergenic
917759832 1:178143891-178143913 TCATTTCTTTCATTCATCATAGG - Intronic
918446779 1:184624635-184624657 TGATGTCTCTTTTTCATCTTTGG + Exonic
919012220 1:191979979-191980001 TTAAGTCTTTAATTTATCTTTGG + Intergenic
919170114 1:193943113-193943135 TGATGTCTTTCTTTCCAATTTGG - Intergenic
919173823 1:193993264-193993286 TGATTTCTTTTATTCCTATTTGG - Intergenic
919574664 1:199293019-199293041 TGATGTCTTTCAGATATTTTGGG - Intergenic
920104174 1:203538963-203538985 TGGTGTCTTTTTTTCCTCTTGGG - Intergenic
920471456 1:206234035-206234057 TTATCTCTTTCATTCATTTTGGG + Intronic
920935110 1:210425484-210425506 TTATGTCTTTAATCGATCTTGGG + Intronic
921327615 1:214002357-214002379 AGATGTCTTTCATTAATTTATGG + Intronic
921878254 1:220224313-220224335 TTATGTCTGCCATTCATCTTTGG - Intronic
921881479 1:220259591-220259613 TTAAGTCTTTAATCCATCTTGGG - Intronic
922384050 1:225062806-225062828 TGAGGTCTATCTTTAATCTTTGG - Intronic
923324339 1:232867875-232867897 TTAGATCTTTCATTTATCTTAGG + Intergenic
924398436 1:243650549-243650571 TTAAGTCTTTAATCCATCTTGGG + Intronic
1063431406 10:5992429-5992451 TGTTGTTTTTCATTCATCTGGGG - Intergenic
1064270594 10:13861827-13861849 TAATGGCTTTCATTGAACTTAGG - Intronic
1064304860 10:14156263-14156285 TGTTGTAATTCATTCATCATGGG - Intronic
1065296960 10:24285368-24285390 TTAAGTCTTTAATCCATCTTGGG + Intronic
1066157051 10:32689654-32689676 TGATGACATTCATTCATCTATGG - Intronic
1066162375 10:32747215-32747237 TTAAGTCTTTGATCCATCTTGGG - Intronic
1068144918 10:53056795-53056817 TGATCTCTTGCATTCCTTTTTGG + Intergenic
1068944004 10:62710252-62710274 CGTTGTTTTTCATTCTTCTTTGG - Intergenic
1069052412 10:63810162-63810184 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1069167268 10:65177502-65177524 TTAAGCCTTTAATTCATCTTGGG + Intergenic
1069335956 10:67350626-67350648 AGATGTTTCTCAGTCATCTTTGG - Intronic
1071005371 10:80878063-80878085 TTAGGTCTTTAATCCATCTTGGG + Intergenic
1071340445 10:84641851-84641873 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1071983358 10:91026029-91026051 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1073724612 10:106215678-106215700 TGATATTTGTCATTCACCTTAGG - Intergenic
1074003800 10:109398463-109398485 TTAAGTCTTTCATCCATCTTGGG - Intergenic
1074230387 10:111528057-111528079 TGATGACTTTCAGGCATTTTGGG + Intergenic
1074679354 10:115888338-115888360 TGATGTCTTTGATTAATATCTGG + Intronic
1076233450 10:128842555-128842577 AGATGTTATTCCTTCATCTTTGG - Intergenic
1076426977 10:130373839-130373861 TAATGTTTTTCATTCATTCTGGG + Intergenic
1076564427 10:131388462-131388484 GGATGGCTTTCATTCATCTCTGG - Intergenic
1079466331 11:20734631-20734653 TGATATCATTCAGTCATCTAAGG + Intronic
1080090249 11:28339679-28339701 TGATGTCTTTCATCAGTTTTAGG - Intergenic
1080165682 11:29233385-29233407 TGATTTCATACAATCATCTTTGG + Intergenic
1081261633 11:40968975-40968997 TGATTTCTTTAATGGATCTTGGG + Intronic
1081479144 11:43467972-43467994 TAATGTCTTTCATAATTCTTAGG - Intronic
1081938791 11:46923061-46923083 TGATGGCTTTTACTCAGCTTAGG - Intergenic
1082285438 11:50312817-50312839 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1082842258 11:57699193-57699215 TGATCTCTTTGAATCATCTGAGG - Exonic
1083529165 11:63402253-63402275 TCAAGCCTTTCATCCATCTTGGG + Intronic
1085884876 11:80510086-80510108 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1085901999 11:80711484-80711506 AGATGTCTACCATTCATGTTTGG - Intergenic
1086732391 11:90266409-90266431 TAAAGTCTTTAATCCATCTTGGG + Intergenic
1087300763 11:96432029-96432051 TTAAGTCTTTAATCCATCTTGGG - Intronic
1087532480 11:99402026-99402048 TGATTTCTTTCTTTCAAATTTGG + Intronic
1087950449 11:104214383-104214405 TGATGTCTTTCTTTCCAATTTGG + Intergenic
1088049279 11:105491858-105491880 TGATGTCTTTATATAATCTTTGG + Intergenic
1088101668 11:106162735-106162757 TAATGTCTTTCATCCATTTTGGG + Intergenic
1088441231 11:109872915-109872937 TTAAGTCTTTAATTCATTTTGGG - Intergenic
1088973689 11:114795747-114795769 GCATGTCTTACATTCAACTTAGG + Intergenic
1090708256 11:129359954-129359976 TCATGTCTTTCATCCATTCTTGG + Intergenic
1091064978 11:132501228-132501250 TTAAGTCTTTGATCCATCTTGGG - Intronic
1091614655 12:2040641-2040663 TTTTGTCTTTTATTCCTCTTTGG - Intronic
1092441188 12:8506150-8506172 TTAAGACTTTAATTCATCTTGGG + Intergenic
1092648533 12:10606947-10606969 TGACATTTTTCATTCACCTTTGG - Intronic
1092812273 12:12282909-12282931 TAATCTCTTTCTTTAATCTTTGG + Intergenic
1093320959 12:17714442-17714464 GGATGTCTTTGATTCAATTTTGG + Intergenic
1093947432 12:25125751-25125773 TTAAGTCTTTCATCCATATTGGG + Intronic
1094245163 12:28282848-28282870 TTAAGTCTTTAATACATCTTGGG + Intronic
1095175347 12:39085514-39085536 TTATGTCTTTAATCCATTTTGGG + Intergenic
1095903452 12:47352971-47352993 TTATTTCTTTAATCCATCTTTGG - Intergenic
1096020284 12:48318585-48318607 AGGTTTCTGTCATTCATCTTGGG + Intergenic
1097256947 12:57684440-57684462 TTAAGTCTTTGATCCATCTTGGG + Intergenic
1097460086 12:59850863-59850885 TCATGTGTTTCATTAGTCTTGGG - Intergenic
1098444187 12:70549482-70549504 TAATGTGTTTCATTCATTGTTGG - Intronic
1098660201 12:73083562-73083584 TTATGTCTTTCATTAAACTTAGG - Intergenic
1099252941 12:80280438-80280460 TTAAGTCTTTAATCCATCTTTGG + Intronic
1099662784 12:85586557-85586579 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1099931516 12:89080930-89080952 TGTTGACTTTCTTTCATATTTGG - Intergenic
1100008659 12:89925580-89925602 TGATGTGTTTAATTGATTTTGGG + Intergenic
1100439987 12:94607859-94607881 TGAAGTCTCTCATTCAACTCAGG + Intronic
1100937396 12:99684925-99684947 TTAAGTCTTTGATTCGTCTTGGG - Intronic
1101234793 12:102777528-102777550 TGATGTCGTTGATTCACATTTGG + Intergenic
1102860015 12:116327857-116327879 TTAAGTCTTTAATCCATCTTAGG - Intergenic
1102901294 12:116639464-116639486 TAATGCCTATTATTCATCTTAGG + Intergenic
1104591694 12:130089080-130089102 TGATATGTTTCATTTCTCTTGGG - Intergenic
1105489986 13:20879070-20879092 TGAGTGCTTGCATTCATCTTTGG - Intronic
1105685626 13:22778232-22778254 AGATGGCTTTCAGTCATCTTAGG - Intergenic
1106435156 13:29717029-29717051 AGAGGTCTTGAATTCATCTTGGG + Intergenic
1107384415 13:39892845-39892867 TGTTGTCTCTTCTTCATCTTTGG - Intergenic
1107838594 13:44433222-44433244 TGATCTCTTACATTCCCCTTTGG - Intronic
1108776072 13:53766772-53766794 TTAAGTATTTCATCCATCTTTGG - Intergenic
1108859430 13:54836424-54836446 TGATTTCTTTCTTTAATCCTTGG + Intergenic
1109150899 13:58846105-58846127 TTAAGTCTTTGATCCATCTTGGG - Intergenic
1109656136 13:65392951-65392973 TGTTGTCTTTCATGCTTCTGTGG + Intergenic
1111471775 13:88693121-88693143 TCATGTCTTGCATTCATTTTGGG + Intergenic
1111478310 13:88784309-88784331 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1111671524 13:91336884-91336906 TTATTTCTTTCATTCAATTTTGG + Intergenic
1112526616 13:100154472-100154494 TGAACTCTTTCTTTCGTCTTAGG + Intronic
1112552434 13:100434249-100434271 TGATGTCTGTGACTCATCTCAGG + Intronic
1112819173 13:103310970-103310992 TCATCTCTTTGATACATCTTTGG - Intergenic
1112892433 13:104254786-104254808 TGTTTTCTTTGACTCATCTTCGG + Intergenic
1113033619 13:106023819-106023841 TTAAGTCTTTAATTCATTTTGGG - Intergenic
1113272696 13:108692006-108692028 TGATGTCTTTCAGTCAACTTAGG - Intronic
1113391149 13:109898498-109898520 TGATGTCTTTCAACACTCTTGGG + Intergenic
1114052554 14:18933386-18933408 TGAAATCTTTCATTCACCTTGGG + Intergenic
1114110003 14:19468539-19468561 TGAAATCTTTCATTCACCTTGGG - Intergenic
1116072194 14:40061651-40061673 TGATGTCTTTTATGTATCTATGG + Intergenic
1116180921 14:41533540-41533562 TCATGTCTTTCATTGAGTTTGGG + Intergenic
1116355913 14:43929712-43929734 TGCTGTCTTACATTCATTTGGGG - Intergenic
1116380870 14:44266266-44266288 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1116506366 14:45687388-45687410 TAAAGTCTTTAATCCATCTTGGG - Intergenic
1116687406 14:48057710-48057732 TTAGGTCTTTAATTCATTTTGGG - Intergenic
1117439184 14:55744339-55744361 TGCATTCTTTCATTCAGCTTTGG + Intergenic
1118161124 14:63291411-63291433 TGATGTCTTTTATAAAACTTGGG + Exonic
1119434879 14:74591886-74591908 TGATGTCTTTTCTACATTTTTGG + Intronic
1119950042 14:78735711-78735733 TGATATCTTTAATTCATATTAGG + Intronic
1120052362 14:79882149-79882171 TGATTTCCTTTATTCATGTTGGG - Intergenic
1120259332 14:82161984-82162006 TTTTTTCTTTCATTCACCTTTGG + Intergenic
1120367097 14:83584831-83584853 TTAAGTCTTTAATTAATCTTTGG + Intergenic
1122394948 14:101418780-101418802 TTATGTCTTTCATTAAATTTGGG - Intergenic
1122686508 14:103510562-103510584 TGATGTCCATCATTCAGCTTGGG + Intergenic
1123485857 15:20737837-20737859 TGGTGTCATTCATTTATGTTAGG - Intergenic
1123542346 15:21306881-21306903 TGGTGTCATTCATTTATGTTAGG - Intergenic
1123814097 15:23959289-23959311 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1124059820 15:26280054-26280076 TTAAGTCTTTAATTTATCTTGGG + Intergenic
1124133603 15:27012441-27012463 TGATGTCTTTCATCACTTTTGGG + Intronic
1125088798 15:35766180-35766202 TGAAGTCTTTCTTCCAGCTTGGG - Intergenic
1125984645 15:44038432-44038454 TTAAGTCTTTAATCCATCTTGGG + Intronic
1126716890 15:51526999-51527021 TGATGTCTTTCTGTAGTCTTGGG - Intronic
1126882631 15:53115681-53115703 TGCTGTCTGGCATTCATGTTTGG - Intergenic
1127202499 15:56671317-56671339 TTAAGTCTTTAATCCATCTTGGG + Intronic
1127244147 15:57152792-57152814 TGATGTCTTTCATTGCTTTTGGG - Intronic
1127946551 15:63760605-63760627 TTTTGTCTTTCATTACTCTTAGG - Intronic
1128400649 15:67276861-67276883 TGGTGTCTGTCATTAATTTTGGG + Intronic
1128502583 15:68237800-68237822 TGCTGTCTTTCTTTTATCTGTGG - Intronic
1128841763 15:70856054-70856076 TGATGGCTCACATTCATCTCAGG + Intronic
1128952906 15:71906139-71906161 TGATGTCTTTCTTTGATTTCTGG + Intronic
1129012779 15:72438097-72438119 TCATGTCTTTCATTTAATTTGGG + Intergenic
1130182917 15:81649779-81649801 TAAAGTCTTTAATCCATCTTAGG + Intergenic
1130614287 15:85389735-85389757 TCATTTCTTTGATTAATCTTAGG - Intronic
1131799933 15:96058317-96058339 TGGTGTCTTTCATTTACATTAGG + Intergenic
1202950663 15_KI270727v1_random:34022-34044 TGGTGTCATTCATTTATGTTAGG - Intergenic
1132970719 16:2687264-2687286 TGTTTTCTTTCATTCTTCCTAGG - Intronic
1133902395 16:9989388-9989410 TTAAGTCTTTAATCCATCTTGGG - Intronic
1137328348 16:47464077-47464099 TTATGTCTTTATTTCTTCTTTGG + Intronic
1137514263 16:49129339-49129361 AGATCACTTTCATTCATTTTAGG - Intergenic
1137927001 16:52549126-52549148 TGATGTACTGCATTCAGCTTTGG + Intergenic
1138733865 16:59228658-59228680 TTTTGTCTTTTATTCTTCTTTGG - Intergenic
1138939270 16:61770532-61770554 TGGTCTCTTTCATTCAGCTATGG - Intronic
1139107123 16:63840064-63840086 TTAAGTCTTTAATTCATCATGGG - Intergenic
1139141679 16:64271029-64271051 TCATGTCTTTCATTAAGTTTGGG - Intergenic
1139407950 16:66734465-66734487 AGATTTTTCTCATTCATCTTGGG + Intronic
1139793767 16:69464618-69464640 AGATGTTTTTCATTCAATTTCGG - Exonic
1139951379 16:70673208-70673230 TCATGTCTTTCATTTGTCCTTGG - Intronic
1140197156 16:72864766-72864788 TGATGGCTTTCATTCTTGGTTGG - Intronic
1140932837 16:79643694-79643716 TTATCTTTTTAATTCATCTTAGG - Intergenic
1142720557 17:1772990-1773012 TGATGTCTGCCATCCATCCTTGG - Intronic
1144049108 17:11482552-11482574 TGAGCTTTTTCATTCATCGTGGG - Intronic
1144502700 17:15803260-15803282 TGAGGTCTTTCAGTCATCATAGG + Intergenic
1145164879 17:20605913-20605935 TGAGGTCTTTCAGTCATCATAGG + Intergenic
1146949676 17:36897212-36897234 TGATGTGCTTCCTTCATCTGGGG + Intergenic
1147198394 17:38782875-38782897 AGCTGACTTTCATTCATCTGTGG - Intronic
1149124371 17:53209956-53209978 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1149235793 17:54589191-54589213 TTAAGTCTTTAATCCATCTTTGG + Intergenic
1149561721 17:57612199-57612221 TGAGTACTTGCATTCATCTTAGG + Intronic
1150024085 17:61653605-61653627 TGTTGTCTATCATTAATTTTGGG - Intergenic
1151021362 17:70621154-70621176 TTATTTCTTTCACTAATCTTTGG + Intergenic
1152155554 17:78630367-78630389 AGATGTCTTTCATTAAGCTGAGG + Intergenic
1152409406 17:80115107-80115129 TGATGTTTTTCATCAAACTTGGG + Intergenic
1152673834 17:81626379-81626401 TGATGTTTTTCATTAAATTTTGG - Intronic
1155898099 18:31354180-31354202 TGTTTTATTTCATTCCTCTTTGG + Intronic
1156187121 18:34676325-34676347 AGAAGTATTTCATTCATTTTGGG - Intronic
1156671607 18:39476799-39476821 TGATCTCTATCCTTAATCTTTGG + Intergenic
1156906222 18:42355378-42355400 TGAAGTCTTTCTTTCATTGTTGG - Intergenic
1157008044 18:43610093-43610115 TGATGGCATTCATTTATATTTGG - Intergenic
1157398600 18:47366743-47366765 TCCTTTCTTTCATTTATCTTTGG + Intergenic
1158419555 18:57280655-57280677 TGATGCCTTTCAGTCAGCTCTGG - Intergenic
1158630164 18:59106535-59106557 TGATGTTATTCATTCTGCTTAGG + Intergenic
1159652855 18:70998322-70998344 TAATGTATTTTATTAATCTTTGG + Intergenic
1160067775 18:75593423-75593445 TGATTTTTTTTTTTCATCTTTGG + Intergenic
1160891867 19:1383313-1383335 TGATGTCTTTCGTTCAGGATTGG - Intergenic
1162229279 19:9252132-9252154 TGATGGCTTTCATTCCTCTCTGG + Exonic
1162479034 19:10917526-10917548 TGATGTTTTTCATTCGTTTTGGG + Intronic
1162852069 19:13438622-13438644 TGAGCTCATTCATGCATCTTTGG - Intronic
1163964162 19:20728626-20728648 TTAAGTCTTTGATCCATCTTGGG - Intronic
1165171849 19:33898320-33898342 TCATGTCTTTCATCAATTTTGGG + Intergenic
1167771344 19:51521452-51521474 TCATGTCTTTCCTCCATCATTGG + Intronic
1168139926 19:54378971-54378993 TGATGTTTTTGATTCATTTTAGG - Intergenic
931163344 2:59718348-59718370 TGATATCTATGACTCATCTTGGG - Intergenic
932076270 2:68666310-68666332 TTAAGTCTTTAATCCATCTTGGG - Intergenic
932144272 2:69305114-69305136 TGAGGACTTCCATTCACCTTTGG - Intergenic
933176975 2:79185479-79185501 TTATGTTTTTCATGTATCTTGGG + Intronic
934113423 2:88763727-88763749 TTAAGTCTTTAATCCATCTTGGG + Intergenic
935529468 2:104215303-104215325 ATATGTCTTTCATTGATATTTGG + Intergenic
936277237 2:111110366-111110388 AGATATCTTTGATTCACCTTTGG + Intronic
936555262 2:113491495-113491517 TTAAGTCTTTAATTTATCTTGGG - Intronic
936717481 2:115205234-115205256 TTAAGTCTTTAATTCATCTTGGG + Intronic
936723970 2:115289845-115289867 TTACGTCTTTAATCCATCTTGGG - Intronic
937137770 2:119569528-119569550 TGATGTCTGACATTCATTTATGG + Intronic
937245563 2:120490180-120490202 TTATCTCTTTCATACATATTTGG - Intergenic
937261510 2:120589256-120589278 TGAAGACTATCAATCATCTTTGG + Intergenic
938176634 2:129138877-129138899 TGATGTCTGTCATTAGTATTTGG + Intergenic
938553909 2:132406115-132406137 TCACGTCTTTTATTCATTTTAGG + Intergenic
939110152 2:137997021-137997043 TTAAGTCTTTAATCCATCTTGGG - Intronic
939577676 2:143915536-143915558 TGATGACCTTTATTCACCTTTGG - Intergenic
939678623 2:145103367-145103389 AGATGTCTTTTATTTTTCTTGGG - Intergenic
939869512 2:147511231-147511253 TGATGTCTTGCTTACATTTTAGG - Intergenic
940011082 2:149056286-149056308 GCCTGTGTTTCATTCATCTTTGG - Intronic
940628117 2:156202157-156202179 TGAAGTCCTTCTTTTATCTTTGG + Intergenic
940726012 2:157337065-157337087 TGCTGTCTTTCATTTATCTTTGG - Intergenic
940996737 2:160157924-160157946 TGAGGTCTTTCATTCTTGTGGGG + Intronic
942793099 2:179783330-179783352 TTAAGTCTTTAATCCATCTTGGG - Intronic
943136802 2:183923853-183923875 TTAAGTCTTTAATCCATCTTGGG - Intergenic
943545992 2:189278623-189278645 TGAATTCTTTCATTTTTCTTTGG + Intergenic
943712044 2:191107977-191107999 TAATGTCTTTCTTTCATTCTTGG - Intronic
943836345 2:192518343-192518365 TTATGTCATTCATGCATCTTAGG + Intergenic
944102487 2:196043413-196043435 TTAAGTCTTTGATCCATCTTGGG - Intronic
944673016 2:202011683-202011705 TGATGTGTTCCTTTCATTTTGGG - Intergenic
944693783 2:202182651-202182673 TCATTTCTTTCATTTATCTTGGG + Intronic
944785871 2:203069648-203069670 TGATGTATCTTATTCATTTTTGG + Intronic
944924207 2:204447003-204447025 TTAAGTCTTTAATCCATCTTGGG + Intergenic
945015060 2:205506630-205506652 TGATGGCTTTTATACTTCTTTGG - Intronic
945387400 2:209219252-209219274 TTATGTCTCTGATCCATCTTAGG - Intergenic
945675592 2:212851917-212851939 TTATGTCTTTCTTTCTTTTTTGG + Intergenic
946122875 2:217531777-217531799 TCATGTCTCTCATTCAGATTGGG - Intronic
946135846 2:217646346-217646368 TGAGGTCTTTCATTTTTCTGAGG - Intronic
947146903 2:227076488-227076510 TTAAGTCTTTAATCCATCTTGGG - Intronic
947355781 2:229293955-229293977 AGATGCCTTTCATACATGTTAGG - Intergenic
948519727 2:238528257-238528279 TGCTTTCTTTAATTCCTCTTTGG - Intergenic
1169619582 20:7490561-7490583 TGAGGTCATTAATTCAGCTTTGG + Intergenic
1170054818 20:12190095-12190117 TAATGTCTTTCATTAAAATTAGG + Intergenic
1170464903 20:16613595-16613617 GGATGTCTTTCAGTCTTGTTTGG - Intergenic
1170776416 20:19378645-19378667 TGATCACGTGCATTCATCTTGGG - Intronic
1171074953 20:22113595-22113617 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1172188408 20:33046358-33046380 CTATGTCTTTCATTCATGTGAGG + Intergenic
1173093321 20:39997748-39997770 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1173368978 20:42417683-42417705 TCATATTATTCATTCATCTTGGG - Intronic
1173393781 20:42659293-42659315 TAATATCTTTCATCTATCTTTGG + Intronic
1175984653 20:62758616-62758638 GGATGTCTCTCTTTCACCTTCGG - Intronic
1176688513 21:9876394-9876416 TTATGTCTTTAATCCATCCTGGG - Intergenic
1178505333 21:33158016-33158038 TTATGTCTTTCACTAATATTAGG + Intergenic
1178731623 21:35108311-35108333 TGATGTCTGTCATTTCTCTAGGG - Intronic
1178780266 21:35596464-35596486 TTATGTCTCTCTTGCATCTTTGG - Intronic
1179184011 21:39069737-39069759 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1180218177 21:46339836-46339858 TGATGTCTTTGATTCTGCTTGGG + Intronic
1180254844 21:46619503-46619525 TGGTGTCTCACATTAATCTTGGG + Intergenic
1180471029 22:15655761-15655783 TGAAATCTTTCATTCACCTTGGG + Intergenic
1181624065 22:24110939-24110961 TGATGTCTTTTATTATTTTTGGG + Intronic
1182382168 22:29900500-29900522 TGATATCATTCATTTATATTAGG + Intronic
1183002206 22:34870152-34870174 TGTTGTCTTTCATTCTTCTGTGG + Intergenic
1183642963 22:39103302-39103324 TTAAGTCTTTAATTCATCTTGGG - Intronic
1184304321 22:43585614-43585636 TGCTGTCTGTCATTAATTTTGGG - Intronic
949174558 3:1044131-1044153 TCATGTCTTTCATTAAATTTAGG + Intergenic
949366217 3:3284202-3284224 TGGTGTCTGTCATTAATTTTGGG + Intergenic
949417113 3:3826858-3826880 GGATGTATTTTATTCCTCTTGGG - Intronic
949594365 3:5528930-5528952 TTAAGTCTTTAATCCATCTTGGG + Intergenic
950437309 3:12987762-12987784 TCATGCCTTTCACCCATCTTGGG - Intronic
951283797 3:20784586-20784608 TCAAGTCTTTAATCCATCTTGGG - Intergenic
951661521 3:25071893-25071915 TGAGGGCTTTCAAGCATCTTTGG - Intergenic
952003759 3:28817657-28817679 TGACATCTTTCATTTGTCTTGGG + Intergenic
953826433 3:46255538-46255560 TTAAGTCTTTGATCCATCTTGGG + Intronic
956036218 3:65095148-65095170 TGATACCCTTCACTCATCTTTGG - Intergenic
956330252 3:68099004-68099026 TTAAGTCTTTAATTCATCTTGGG - Intronic
956950670 3:74278606-74278628 TTAAGTCCTTCATCCATCTTGGG - Intronic
957176613 3:76819025-76819047 TAAAGGCTTTCATTGATCTTAGG + Intronic
958096947 3:88958251-88958273 TGATGTTTTCCATTCTTATTAGG + Intergenic
958521877 3:95201179-95201201 TGACTTTTTTTATTCATCTTTGG - Intergenic
958742426 3:98091232-98091254 TTAAGTCTTTAATCCATCTTGGG + Intergenic
958872373 3:99575872-99575894 TTATGTCTTTCAATAATTTTGGG + Intergenic
960688539 3:120318742-120318764 TTAAGTCTTTAATCCATCTTGGG - Intergenic
960782716 3:121337575-121337597 TGATGTCTTTCTCTTTTCTTAGG - Intronic
960832770 3:121867254-121867276 TTATGTCTTTCATAAAACTTGGG - Intronic
960840264 3:121950901-121950923 TTATGTCTTTCATTAGTTTTGGG + Intergenic
963014125 3:140804350-140804372 TTAAGTCTTTGATCCATCTTGGG + Intergenic
963869488 3:150399499-150399521 AGATGTCTTTGCTTCAGCTTTGG - Intergenic
964217654 3:154305165-154305187 TCATGTCTTTCATTCACAGTCGG - Exonic
964285991 3:155118909-155118931 TGATGTTTTTCATTCATGACAGG + Intronic
965281196 3:166755196-166755218 TGATGTCTATCATTCAATTTGGG - Intergenic
965716404 3:171608939-171608961 TGTTGGCTTTTAGTCATCTTTGG - Intronic
966000123 3:174939150-174939172 TTAAGTCTTTAATCCATCTTGGG + Intronic
966071303 3:175882042-175882064 TGATGTATTTCATGCATTTACGG - Intergenic
966451253 3:180064877-180064899 TGATTTCATTTATGCATCTTTGG - Intergenic
966490390 3:180521525-180521547 TTAAGTCTTTAATCCATCTTGGG - Intergenic
966726173 3:183110781-183110803 TTAAGTCTTTAATCCATCTTGGG + Intronic
967631487 3:191747474-191747496 TTAAGTCTTTAATCCATCTTGGG + Intergenic
968714880 4:2149352-2149374 AAATGTCTTTATTTCATCTTTGG - Intronic
970764267 4:19528449-19528471 TCATGTCTTTAATCCATTTTGGG - Intergenic
971509142 4:27402162-27402184 TTAAGTCTTTGATCCATCTTTGG - Intergenic
971649904 4:29258134-29258156 TGATGTGTTTCTTTCATGTAAGG + Intergenic
972691800 4:41406329-41406351 TGATTGCTTTCATTTTTCTTTGG + Intronic
972954607 4:44373695-44373717 TGATGTTTTTCATTTATTTATGG - Intronic
973533228 4:51853704-51853726 TGGTGTTTTTCAGTCTTCTTAGG + Intronic
973728455 4:53800014-53800036 CGATGAGTTTCATTCATCTCTGG - Intronic
973972941 4:56232448-56232470 AGATGTCTTTCATTTTTGTTGGG + Intronic
974556210 4:63451951-63451973 GGATTTCTTTAATTCAACTTAGG + Intergenic
974677718 4:65116134-65116156 TGATGTCTTTCTTTCTTATGTGG - Intergenic
974889033 4:67856479-67856501 TTAAGTCTTTAATACATCTTGGG - Intronic
975927726 4:79478516-79478538 TTAAGTCTTTAATCCATCTTGGG + Intergenic
976509100 4:85887211-85887233 TGATGTCTTACATAAACCTTTGG - Intronic
976851188 4:89547955-89547977 TTATGTCTTTAATCCATTTTGGG - Intergenic
977120584 4:93094819-93094841 TGATGTCTTTAATTCAATTTTGG - Intronic
977467279 4:97398468-97398490 TTAAGTCTTTAATCCATCTTGGG + Intronic
977517560 4:98040461-98040483 TTAAGTCTTGAATTCATCTTGGG + Intronic
977705356 4:100064670-100064692 AGATGTCCTTCATTTATCCTGGG + Intergenic
978199256 4:106006363-106006385 TGACTTCTTTCATTCAGGTTTGG - Intergenic
978652927 4:111029674-111029696 TTGTGTCTTTGATTCATTTTCGG + Intergenic
979326035 4:119380852-119380874 TTAAGTCTTTAATCCATCTTGGG + Intergenic
979500293 4:121432612-121432634 TGAGGTATTTAATTCATCTTGGG + Intergenic
979770428 4:124517880-124517902 TGATGTCTTTCACTGAACTTGGG - Intergenic
980024298 4:127746915-127746937 TTAAGTCTTTAATCCATCTTGGG + Intronic
980671396 4:136011819-136011841 TGATTTCTTTCTTCCTTCTTTGG - Intergenic
983103632 4:163657910-163657932 TTAAGTCTTTAATCCATCTTGGG - Intronic
983243895 4:165265518-165265540 TTAAGTCTTTAATCCATCTTGGG + Intronic
983291185 4:165808329-165808351 AGATGTCCATCATTCATCATTGG + Intergenic
984309319 4:178036512-178036534 TTATGTCTTTCATTTGTCTGTGG - Intergenic
984774710 4:183471190-183471212 TGATGTCTTTCCTTGCTCATAGG - Intergenic
984794973 4:183651629-183651651 TGATGTCTTATTTTCATCCTCGG - Intronic
985225419 4:187755081-187755103 TTAAATCTTTAATTCATCTTGGG + Intergenic
985625697 5:984970-984992 TGATGTCTTTCATTGATTTTGGG - Intergenic
986074655 5:4323510-4323532 TTAGGTCTTTCATACATTTTAGG - Intergenic
986086518 5:4456905-4456927 TCAGGTCTTTCATACAGCTTTGG - Intergenic
986323161 5:6650054-6650076 TGTTGTCTTTCTTTCTTCTCGGG + Intronic
986358997 5:6957119-6957141 TTAAGTCTTTAATCCATCTTGGG - Intergenic
986753263 5:10810034-10810056 TTATGTCTTTCATTTTTCTTCGG - Intergenic
986861288 5:11929204-11929226 TGATGTACTCCAGTCATCTTGGG + Intergenic
986945449 5:13013052-13013074 TTAAGTCTTTAATCCATCTTGGG + Intergenic
986984951 5:13490144-13490166 TTAAGTATTTAATTCATCTTGGG + Intergenic
987010885 5:13762996-13763018 TGATGCCCTTCATTCATTTGTGG - Intronic
987640003 5:20600559-20600581 TGATATATTTAATTCATCTGAGG - Intergenic
987741368 5:21913149-21913171 TGGTTTCTATGATTCATCTTAGG + Intronic
987758359 5:22125981-22126003 TTGTGTATTTCATTCATTTTGGG + Intronic
987777717 5:22390758-22390780 TGATGTTTTTCATGCAAGTTAGG - Intronic
987846291 5:23291427-23291449 TTAAGTCTTTGATTCATGTTGGG + Intergenic
988015244 5:25548441-25548463 GGATGTCTTTTATTTATTTTTGG + Intergenic
988576502 5:32430561-32430583 TGTTATCTTTCATTAATTTTAGG - Intronic
990259117 5:54002253-54002275 TGATGTCTTTCATTCATCTTTGG - Intronic
990860513 5:60321393-60321415 TTAAGGCTTTAATTCATCTTGGG - Intronic
991749117 5:69780118-69780140 TTGTGTATTTCATTCATTTTGGG + Intergenic
991800698 5:70359929-70359951 TTGTGTATTTCATTCATTTTGGG + Intergenic
991827902 5:70650112-70650134 TTGTGTATTTCATTCATTTTGGG - Intergenic
991893057 5:71359370-71359392 TTGTGTATTTCATTCATTTTGGG + Intergenic
992037082 5:72790574-72790596 TGGAGTCATTGATTCATCTTTGG - Intergenic
993313808 5:86373734-86373756 TTAAGTCTTTAATCCATCTTGGG - Intergenic
993408490 5:87543999-87544021 TGATGACTTTGATGTATCTTAGG - Intergenic
993555865 5:89337178-89337200 TTATGTCCTTAATCCATCTTGGG - Intergenic
993781553 5:92072295-92072317 TGATATCTGTCATTTAACTTTGG - Intergenic
993995141 5:94713524-94713546 TGCTGTCTTTCTTTTATCTGGGG - Intronic
994595624 5:101830128-101830150 TGAGGTCTATGATTCATTTTTGG + Intergenic
994808523 5:104481761-104481783 TTAAGTCTTTAATCCATCTTGGG + Intergenic
994904773 5:105824700-105824722 TGATGTTTTTCTTTCATATTAGG - Intergenic
995029511 5:107464365-107464387 TGCTGTCTTTCATTTATTCTGGG - Intronic
995436187 5:112138370-112138392 TGGTATCTTTCATTCCTCTAGGG + Intergenic
995895581 5:117006796-117006818 TTAAGTCTTTAATTCATCTTGGG + Intergenic
995907233 5:117140419-117140441 TAATGTCTTTAGTGCATCTTGGG - Intergenic
995935595 5:117508189-117508211 TTAAGTCTTTAATGCATCTTGGG + Intergenic
996074432 5:119173471-119173493 TGGACTCTCTCATTCATCTTTGG + Intronic
996850809 5:127949885-127949907 TTATGACTTTAATTCATCTTTGG - Intergenic
997056093 5:130446846-130446868 TTAAGTCTTTAATCCATCTTGGG - Intergenic
998768658 5:145516986-145517008 TTAAGTCTTTAATCCATCTTGGG - Intronic
1000295854 5:159912900-159912922 TGCTTGGTTTCATTCATCTTTGG + Intergenic
1000804934 5:165778189-165778211 CGATTTCTTTAATTCATATTTGG + Intergenic
1001120774 5:168978157-168978179 GGGTGTCTTTCCTTCCTCTTGGG - Intronic
1002672479 5:180879372-180879394 TTATGTCTTTTATCCATTTTGGG + Intergenic
1003033873 6:2625620-2625642 TGGTTTCTTTCAAGCATCTTTGG + Intronic
1003394120 6:5738474-5738496 TGCTCTCTGTCATTCATCTTTGG - Intronic
1003461658 6:6334450-6334472 TGATGTCTCCCATGCAGCTTTGG - Intergenic
1003942234 6:11041568-11041590 AGGTATCTTTCATTCATCTTTGG + Intronic
1005131187 6:22510329-22510351 TGATGTCTTTTTTCCATTTTGGG + Intergenic
1005142283 6:22646592-22646614 TGATAGCTTTCTTTCATCTTTGG + Intergenic
1006249956 6:32774827-32774849 TGATGGCTTTCATGAAACTTCGG - Intergenic
1006689187 6:35865789-35865811 TCATGTCTTTAATTGGTCTTGGG - Intronic
1008190613 6:48452491-48452513 TTAAGTCTTTTATCCATCTTGGG - Intergenic
1008467537 6:51847396-51847418 TAATATCTTTAATTCATCTTAGG - Intronic
1008723298 6:54385129-54385151 TTATTTCTTTCATTTATCTTCGG - Intronic
1008865879 6:56209023-56209045 TTAAGTCTTTAATCCATCTTGGG - Intronic
1009756070 6:67941760-67941782 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1010023206 6:71185510-71185532 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1010141588 6:72620764-72620786 TGATGATTTTCTTTCATATTTGG + Intergenic
1011214646 6:84992435-84992457 TTAAGTCTTTAATCCATCTTAGG - Intergenic
1011323440 6:86122400-86122422 ACATTGCTTTCATTCATCTTAGG + Intergenic
1011503471 6:88015838-88015860 TTAGGTCTTTAATTCATCTTGGG + Intergenic
1011831101 6:91372540-91372562 TTAAGTCTTTAATTCATCTTGGG + Intergenic
1011896732 6:92236970-92236992 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1012007190 6:93727855-93727877 TAAATTCTTTCATTTATCTTGGG - Intergenic
1012228328 6:96730849-96730871 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1012678418 6:102146980-102147002 TTAAGTCTTTAATACATCTTGGG - Intergenic
1012818638 6:104056815-104056837 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1012836294 6:104273308-104273330 TTCTGTCTTTCATGTATCTTGGG + Intergenic
1012965994 6:105673944-105673966 TTAAGTCTTTGATCCATCTTGGG - Intergenic
1013854472 6:114555269-114555291 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1013968837 6:115990419-115990441 TTAAGTCTTTAATCCATCTTGGG + Intronic
1013984705 6:116176551-116176573 TGATATCTTTCATTATTTTTTGG - Intronic
1014207226 6:118669389-118669411 TTATATCTTTCCTTCATCTCTGG + Intronic
1016660654 6:146575361-146575383 TTAAGTATTTCATTCATTTTGGG - Intergenic
1016928111 6:149373996-149374018 TGATGTGTTTCAATCAGTTTTGG - Intronic
1017069633 6:150563584-150563606 ACATGGCTTTCATTTATCTTGGG - Intergenic
1019583924 7:1785843-1785865 CTATGTCTTTCATTCATTCTAGG + Intergenic
1019833092 7:3353287-3353309 TGATGAGTATCTTTCATCTTGGG + Intronic
1020495004 7:8839564-8839586 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1020712454 7:11624804-11624826 TGATGTCTTTAATTCTGTTTAGG - Intronic
1020889212 7:13857730-13857752 TGGAGTCTCTCATTCCTCTTAGG + Intergenic
1020995836 7:15262927-15262949 TTAAGTCTTTGATCCATCTTGGG - Intronic
1021162009 7:17285519-17285541 AGATGGCTTTCATTCATTTGGGG + Intergenic
1021339889 7:19451988-19452010 TTAAGTCTTTGATCCATCTTTGG + Intergenic
1021733080 7:23616249-23616271 TGATGCCTTCCAGTCATCTCTGG + Intronic
1022390568 7:29940296-29940318 TGTTGTCTCTTACTCATCTTAGG - Intronic
1022412197 7:30148101-30148123 TGATTTCTTTCCTTTCTCTTTGG - Intronic
1022532532 7:31076025-31076047 TGCTGTGTTTGAATCATCTTTGG + Intronic
1024365300 7:48513447-48513469 TGTTTTCTTTCATTCATTTTAGG - Intronic
1025109978 7:56206457-56206479 TGATTTCTGCCATTCAGCTTTGG - Intergenic
1025962168 7:66232118-66232140 AGATGTGTTTCAGTCCTCTTGGG + Intronic
1026081188 7:67222711-67222733 TTATGTCTTTCATTAAATTTAGG + Intronic
1026695897 7:72591300-72591322 TTATGTCTTTCATTAAATTTAGG - Intronic
1026712050 7:72750596-72750618 TGATGTCTTTCATCAAATTTGGG + Intronic
1027401968 7:77818400-77818422 TTAGGTCTTTGATTCATTTTGGG + Intronic
1027838216 7:83273727-83273749 TTAATTCTTTAATTCATCTTGGG + Intergenic
1028659307 7:93250542-93250564 TTAAGTCTTTAATCCATCTTGGG - Intronic
1028929187 7:96393998-96394020 TGATGTCTTCCTTTCAAATTTGG + Intergenic
1029009419 7:97243018-97243040 TGATTTCTTTTTTTCTTCTTTGG - Intergenic
1029678239 7:102087957-102087979 TGTTAGCTTTCATTCATCTGGGG + Intronic
1030040429 7:105445153-105445175 TGATGTCTGTCATTAATTTTGGG - Intronic
1030255226 7:107503144-107503166 TGAAGTCTTTGATCCATCTTGGG + Intronic
1030646684 7:112069333-112069355 TTATGTCTTTCATTAATAGTTGG - Intronic
1030813386 7:114004321-114004343 TTAAGTCTATAATTCATCTTGGG - Intronic
1031171802 7:118301436-118301458 TGATGTCATTTATTTATTTTAGG + Intergenic
1031219994 7:118952982-118953004 TTAAGTCTTTGATCCATCTTGGG + Intergenic
1031508423 7:122617720-122617742 TGAATTCTTTCATTGATATTAGG - Intronic
1031595301 7:123643106-123643128 TAATGTCTCTCATTTATCCTGGG + Intergenic
1031707539 7:124999570-124999592 GTAAGTCTTTCATTCATCTCTGG + Intergenic
1031791798 7:126116196-126116218 TCATGTCTTTCATTTCTCCTTGG - Intergenic
1031938984 7:127767143-127767165 TGATGGCATTCCTTTATCTTTGG + Intronic
1032618653 7:133503315-133503337 TGGTCTCTTCCATTCATTTTTGG - Intronic
1033260112 7:139836663-139836685 TTAAGTCTTTAACTCATCTTGGG - Intronic
1033573889 7:142661235-142661257 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1034040474 7:147871878-147871900 TGGTGTCTTTCCTTCAGCTCTGG + Intronic
1035648934 8:1249620-1249642 TTATGTCTTTCATTCAGTTCAGG - Intergenic
1036047375 8:5158998-5159020 TGATGCCTTTTATTCCTCTTTGG + Intergenic
1036625590 8:10469019-10469041 TGATGTCTTTCATCAATTCTTGG - Intergenic
1037047522 8:14326652-14326674 TGAAATCGTTCATTCATTTTGGG - Intronic
1037184746 8:16048946-16048968 TGATGTCTTTCATTTGAATTTGG - Intergenic
1037509303 8:19565449-19565471 TTATGACATTCATTCATCTCAGG + Intronic
1038233104 8:25724083-25724105 TTAAGTCTTTAATTCATCTTGGG + Intergenic
1039072852 8:33662004-33662026 TGATTTTTTTCTTTCATTTTAGG + Intergenic
1039177187 8:34822929-34822951 TAATTTCATTCATTCATTTTTGG + Intergenic
1039368679 8:36961531-36961553 TTAAGTCTTTAATTCATTTTGGG + Intergenic
1039889768 8:41677014-41677036 TAATGTCTTTCATTTATATGGGG + Intronic
1040694367 8:49978358-49978380 TGCTTTCTTTTCTTCATCTTTGG - Intronic
1041123526 8:54611228-54611250 TCATGTATTTCATCCAACTTGGG + Intergenic
1041140377 8:54811796-54811818 TGATGCTTTTCATTGAACTTAGG + Intergenic
1042095208 8:65208003-65208025 TAAAGTCTTTGATTCATCTTTGG + Intergenic
1042522793 8:69732043-69732065 TGATTTGTTTCATTCTTCTAAGG - Intronic
1043573159 8:81628141-81628163 TTATTTCTTTCTATCATCTTGGG - Intergenic
1044268290 8:90209164-90209186 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1044802687 8:95973405-95973427 TTAAGTCTTTGATCCATCTTAGG - Intergenic
1045149018 8:99381970-99381992 TTAAGTCTTTGATCCATCTTGGG + Intronic
1045829444 8:106441061-106441083 TTAAGTCTTTAATCCATCTTGGG + Intronic
1046111161 8:109726959-109726981 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1046134478 8:110009389-110009411 TTAAGTCTTTAATACATCTTCGG + Intergenic
1046196530 8:110871203-110871225 TTATGTATTTCATTCATATGAGG + Intergenic
1046438230 8:114223415-114223437 TGCTGTATTTCATTGATCCTAGG + Intergenic
1046729737 8:117712151-117712173 GTTTGTGTTTCATTCATCTTTGG + Intergenic
1047102458 8:121693126-121693148 TTAAGTCTTTAATTCATCTTGGG - Intergenic
1047164713 8:122424648-122424670 GTAAGTCTTTCATTCATCTTGGG + Intergenic
1047914637 8:129569053-129569075 TAATCTTTTTTATTCATCTTTGG + Intergenic
1048495598 8:134933275-134933297 AGAGGTGTTTCAGTCATCTTTGG + Intergenic
1048903126 8:139059197-139059219 TGCTGTCTTTCATTACTTTTAGG + Intergenic
1049897737 9:125689-125711 TTAAGTCTTTAATTTATCTTGGG + Intronic
1050144801 9:2555810-2555832 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1050924804 9:11250454-11250476 TCATGTCTTTCATTAAACTTGGG - Intergenic
1050974127 9:11915096-11915118 CGATTTCTTTCAATTATCTTAGG - Intergenic
1051040814 9:12808750-12808772 TTGTGTCTGTCATTCATTTTGGG + Intronic
1051715866 9:19983192-19983214 TTATGTCTTTCATTCCAGTTTGG - Intergenic
1051853115 9:21531956-21531978 GGATGACTTTGATTCATCTGGGG - Intergenic
1051994086 9:23193041-23193063 TTAAGTCTTTAATTCATCTTGGG - Intergenic
1052514389 9:29461441-29461463 TTAAGTCTTTCATTTGTCTTGGG + Intergenic
1052636847 9:31117491-31117513 TCGTGTCTTTAATTCATTTTAGG - Intergenic
1052678480 9:31657622-31657644 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1052703419 9:31965144-31965166 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1052776173 9:32735074-32735096 TGTTGGCTTTCATTCATGTTGGG - Intergenic
1053740826 9:41135979-41136001 TTAAGTCTTTAATTTATCTTGGG + Intronic
1053780821 9:41605504-41605526 TTATGTCTTTAATCCATCCTGGG + Intergenic
1054168764 9:61815661-61815683 TTATGTCTTTAATCCATCCTGGG + Intergenic
1054443815 9:65292124-65292146 TTAAGTCTTTAATTTATCTTGGG + Intergenic
1054486458 9:65729379-65729401 TTAAGTCTTTAATTTATCTTGGG - Intronic
1054668767 9:67765150-67765172 TTATGTCTTTAATCCATCCTGGG - Intergenic
1054687525 9:68295320-68295342 TTAAGTCTTTAATTTATCTTGGG - Intronic
1055149640 9:72980900-72980922 GAGTGTCTTTCATTCATCTTTGG + Intronic
1055409239 9:76010080-76010102 TGATGTCTTTCTTTCTACTTGGG + Intronic
1055709410 9:79043765-79043787 TGATATCTTTCTTTCAACTATGG - Intergenic
1056033202 9:82575103-82575125 TCATGTCTTTAATCCAACTTGGG - Intergenic
1056049317 9:82751664-82751686 TAATGTCATTTATTTATCTTCGG + Intergenic
1056991455 9:91415339-91415361 TGCTTTCTTTCATTCACTTTTGG + Intronic
1057544780 9:96009946-96009968 TGATGTCTTTTATTTATCCAAGG - Intronic
1057888358 9:98848618-98848640 TTATCTCTTTCACTCCTCTTAGG - Intronic
1058234541 9:102473367-102473389 TGATGTTTTTGTTTCATTTTTGG + Intergenic
1058248196 9:102657299-102657321 TGATGTCTTTATTGCATCATTGG - Intergenic
1058303353 9:103405553-103405575 TGATGTCTTTCATCTCTATTGGG + Intergenic
1058362691 9:104168618-104168640 TTATGTCTTTCATACAGTTTTGG - Intergenic
1059230113 9:112712836-112712858 TGATGTCTTTCACTAAATTTGGG - Intronic
1059413162 9:114146502-114146524 TGAAGTTTTTCATTCCTGTTTGG + Intergenic
1059657926 9:116373210-116373232 TGATTTTTTTCATTCATTTATGG + Intronic
1060090976 9:120743195-120743217 TGATGACATTCATTCATCCCTGG + Intergenic
1060102404 9:120852014-120852036 TGATGTCTGTCATTCAGGCTAGG - Intergenic
1060415843 9:123429694-123429716 TTAGGTCTTTAATCCATCTTGGG - Intronic
1060502471 9:124171594-124171616 TGTTGTCTTTCATTAATTTTAGG + Intergenic
1061105301 9:128525538-128525560 TAATGTATTTCATTCAGTTTTGG + Intronic
1186030291 X:5361394-5361416 AAATGTCTTTAAATCATCTTGGG + Intergenic
1186681940 X:11884000-11884022 GGATGTCCTTTCTTCATCTTAGG + Intergenic
1186850069 X:13570920-13570942 TGATGTCTTGCTTTCTACTTAGG + Intronic
1187695735 X:21918076-21918098 TTAAGTCTTTGATCCATCTTGGG + Intergenic
1187751919 X:22475789-22475811 TGATGTCTTTCATCACTTTTGGG - Intergenic
1188273666 X:28175226-28175248 TGCTGTCTTTCATTTATTTTAGG + Intergenic
1188279908 X:28254508-28254530 TAGTGTCTTTTATTCCTCTTTGG - Intergenic
1188999450 X:36927918-36927940 TTATGTCTTTCATCAATATTGGG + Intergenic
1189508790 X:41640054-41640076 AGATGTGTTTCATTTTTCTTAGG + Intronic
1190619983 X:52277454-52277476 TGATCACTTTCAATCATTTTGGG + Intergenic
1190905775 X:54726283-54726305 TTAAGTCTCTAATTCATCTTGGG - Intergenic
1191685336 X:63884163-63884185 TTAAGTCTTTAATTTATCTTGGG - Intergenic
1191785436 X:64912588-64912610 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1191910662 X:66145999-66146021 TTAGGTCTTTGATTCATTTTGGG + Intergenic
1192005843 X:67211328-67211350 TGATGTCTTTACTTCTCCTTTGG + Intergenic
1192040470 X:67615188-67615210 TGATGTTTTTCATTAAATTTTGG - Intronic
1192193856 X:69015721-69015743 TGAGGTCATTCATTCATCAGGGG + Intergenic
1192422331 X:71044719-71044741 TGATGCATTTGATCCATCTTTGG - Intergenic
1193487033 X:82098343-82098365 TGATTTCTTTCATTCCAATTTGG + Intergenic
1193500680 X:82270590-82270612 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1193575972 X:83195676-83195698 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1193851478 X:86542901-86542923 TGATGATTTTCATTGAGCTTTGG - Intronic
1194105782 X:89765322-89765344 TTATGTCTTTCATCAAACTTGGG + Intergenic
1194168473 X:90552499-90552521 TTAAGTCCTTGATTCATCTTGGG - Intergenic
1194263030 X:91721087-91721109 TTAAGTCTTTGATCCATCTTTGG - Intergenic
1194333149 X:92610737-92610759 TTAAATCTTTAATTCATCTTAGG + Intronic
1194538020 X:95131710-95131732 TTAAGTCTTTAATCCATCTTGGG - Intergenic
1195338033 X:103876675-103876697 TTTTTTCTTTCATTCATCTATGG + Intergenic
1195525345 X:105882749-105882771 TTATGTCTATAATTCATGTTAGG + Intronic
1195909210 X:109872456-109872478 TGGTGACTTTCAATCAACTTTGG + Intergenic
1196251643 X:113467876-113467898 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1197146467 X:123177844-123177866 TCATGTCTTTCATCTTTCTTGGG + Intergenic
1197465597 X:126800864-126800886 TGATGTCTTTCTTTCTAATTTGG - Intergenic
1197680506 X:129378322-129378344 TTATGTCTTTCTTCCATTTTGGG - Intergenic
1198548000 X:137713784-137713806 TTAAGTCTTTAATCCATCTTGGG + Intergenic
1198885292 X:141328682-141328704 TTAAGTCTTTAATCCATCTTCGG - Intergenic
1199353850 X:146837040-146837062 TGAGTTGTTTGATTCATCTTTGG - Intergenic
1200457744 Y:3413182-3413204 TTATGTCTTTCATCAAACTTGGG + Intergenic
1200514716 Y:4130285-4130307 TTAAGTCCTTGATTCATCTTGGG - Intergenic
1200641833 Y:5729762-5729784 TTAAATCTTTAATTCATCTTAGG + Intronic
1201337707 Y:12898175-12898197 TAATGTCTTGCATTAATGTTTGG + Intergenic
1201704326 Y:16918924-16918946 TTAAGTCTTTAATCCATCTTGGG + Intergenic