ID: 990259120

View in Genome Browser
Species Human (GRCh38)
Location 5:54002279-54002301
Sequence GTCCTCTAAACATTAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990259117_990259120 3 Left 990259117 5:54002253-54002275 CCAAAGATGAATGAAAGACATCA 0: 1
1: 0
2: 3
3: 64
4: 507
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259115_990259120 11 Left 990259115 5:54002245-54002267 CCCTTTATCCAAAGATGAATGAA 0: 1
1: 0
2: 4
3: 32
4: 388
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259116_990259120 10 Left 990259116 5:54002246-54002268 CCTTTATCCAAAGATGAATGAAA 0: 1
1: 0
2: 7
3: 32
4: 383
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data
990259114_990259120 28 Left 990259114 5:54002228-54002250 CCAATTTAATAATGGTGCCCTTT 0: 1
1: 0
2: 1
3: 18
4: 205
Right 990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990259120 Original CRISPR GTCCTCTAAACATTAATGGA GGG Intronic
No off target data available for this crispr