ID: 990262286

View in Genome Browser
Species Human (GRCh38)
Location 5:54036416-54036438
Sequence ATGTAGAAGTAGAAATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 405}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990262286_990262288 5 Left 990262286 5:54036416-54036438 CCATCCAATTTCTACTTCTACAT 0: 1
1: 0
2: 2
3: 39
4: 405
Right 990262288 5:54036444-54036466 CATATTCCAATACTGACTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990262286 Original CRISPR ATGTAGAAGTAGAAATTGGA TGG (reversed) Intronic
900011430 1:113588-113610 ATTTAGGAGAAGAAATTGTATGG + Intergenic
900027532 1:290154-290176 ATTTAGGAGAAGAAATTGTATGG + Intergenic
900041489 1:469596-469618 ATTTAGGAGAAGAAATTGTATGG + Intergenic
900062923 1:704573-704595 ATTTAGGAGAAGAAATTGTATGG + Intergenic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
900558136 1:3290229-3290251 ATTTGGAAGTAGACATGGGAAGG + Intronic
903102031 1:21038507-21038529 ATGTAGAAGAAGAAACTGACAGG - Intronic
903255278 1:22093868-22093890 CTCTAGAAGTAGTCATTGGATGG + Intergenic
904397519 1:30232111-30232133 ATGTAGAAATAGAAAATGCAGGG + Intergenic
905348228 1:37326307-37326329 AGGTAGGAATAGAAATGGGATGG - Intergenic
905905806 1:41617783-41617805 ATGTGGGAGTAGAATTTGGCTGG - Intronic
906054739 1:42906667-42906689 ATGAAGGGGTAGAAATGGGAAGG - Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
907200219 1:52720463-52720485 ATGTAGAAATAAAAAATGTAAGG - Intergenic
907729365 1:57050867-57050889 ATGAATAAATAGAAATTGTAAGG + Intronic
908488526 1:64619149-64619171 ATGTAGATGGTGAAATTGGAAGG + Intronic
909990630 1:82219305-82219327 ATGTAGGATTAAAAATTGGATGG - Intergenic
910082816 1:83361746-83361768 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
910317098 1:85898462-85898484 ATATAGACTTAGAAATTGTAGGG - Intronic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
911295812 1:96113582-96113604 ATGTATAAGGGCAAATTGGATGG - Intergenic
911818796 1:102389368-102389390 AAGGAGAAGTAGAAATTAGCAGG + Intergenic
911986080 1:104624572-104624594 ATGAGAAAGTAGAAACTGGAAGG + Intergenic
912656763 1:111492944-111492966 ATTTAGATGTATAAATAGGAAGG + Intronic
915057259 1:153144851-153144873 ATGTTGAAGTAAAAATGGGTTGG + Intergenic
915262975 1:154692503-154692525 ACGTAAAAGAACAAATTGGAAGG - Intergenic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
916330397 1:163609960-163609982 ATGGAGAGGTGGAAATGGGATGG + Intergenic
916876546 1:168975750-168975772 AAATAGACGTAGACATTGGATGG - Intergenic
917222319 1:172745086-172745108 GTGTAGAAGTTGAAAGTGAATGG + Intergenic
917985736 1:180316596-180316618 ATGAAGAATTAGAAATTGAAAGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918183976 1:182111125-182111147 AAGTGGAGGTAGAAAGTGGATGG + Intergenic
918243112 1:182637336-182637358 AGGTAGGAGGAGAAATGGGAGGG - Intergenic
918400687 1:184159665-184159687 ATGGAGAAAAAGAAATTGTAGGG + Intergenic
918751988 1:188284301-188284323 ATGCAGAGGTAGAAATTGCAAGG + Intergenic
918788422 1:188794425-188794447 ATGTAAAAATAGACATTGAATGG - Intergenic
918805908 1:189044212-189044234 ATGTGGAAATAGAATATGGAAGG - Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
922259870 1:223929598-223929620 ATTTAGGAGAAGAAATTGTATGG + Intergenic
922912720 1:229231081-229231103 AGGTAGAAGCAGAAATTAGGCGG + Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924011854 1:239673798-239673820 ATGTAGGTATAGAAATTGCATGG - Intronic
924908854 1:248487312-248487334 AGGAAGAACTAGAATTTGGAGGG - Intergenic
924915253 1:248560750-248560772 AGGAAGAACTAGAATTTGGAGGG + Intergenic
1064182706 10:13133037-13133059 ATGTAAAAGTATAAAATAGATGG - Intronic
1064495383 10:15904331-15904353 ATTTAAAAATAAAAATTGGAGGG + Intergenic
1064668517 10:17683607-17683629 ATGTAAAATTAAAAAGTGGATGG - Intronic
1065220584 10:23492073-23492095 ATATAAAAGTAGTAATTGGCAGG - Intergenic
1066473402 10:35721530-35721552 ATGTAGAAGTAGAAAATGAAAGG + Intergenic
1066735438 10:38473260-38473282 ATTTAGGAGAAGAAATTGTATGG - Intergenic
1067483486 10:46622878-46622900 ATGAAGAAGAACAAATTTGAAGG - Intergenic
1067611269 10:47718768-47718790 ATGAAGAAGAACAAATTTGAAGG + Intergenic
1067962448 10:50870295-50870317 ATGGACAAAAAGAAATTGGAAGG + Intronic
1069249308 10:66247209-66247231 AAGAAGAAGTAGAGAATGGAAGG + Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071345879 10:84692081-84692103 ATGTGGAGGTAGAACGTGGAGGG + Intergenic
1071460871 10:85894481-85894503 AGGTAGAGGTAGAAATTATATGG + Intronic
1071626688 10:87179015-87179037 ATGAAGAAGAACAAATTTGAAGG + Intronic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073535508 10:104273162-104273184 ATCAAGAAGGACAAATTGGATGG - Intronic
1073563243 10:104514853-104514875 ATGTACGAGTAGAAAGTTGATGG - Intergenic
1073651917 10:105370109-105370131 ATTTTGATGTAGAAATTGCAAGG - Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1076967763 11:105824-105846 ATTTAGGAGAAGAAATTGTATGG + Intergenic
1077937666 11:6805967-6805989 ATTTTAAAGTAGAAATTGAAAGG - Intergenic
1077977891 11:7267962-7267984 ATGTAGAAATACAAATTGAGTGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078178569 11:8989882-8989904 TTGTAGAAGTGAAGATTGGAAGG + Intronic
1078841525 11:15080001-15080023 AAATAGAAGTCGAAATTGGAAGG + Intronic
1079277972 11:19059332-19059354 ATGGGGAAATAGAAATTGGAAGG + Intronic
1079932008 11:26575433-26575455 ATTTTGAAGTAGAAATTGGATGG + Intronic
1081002270 11:37689930-37689952 GTGTATAAGTAGAAATGGGCAGG - Intergenic
1081398977 11:42620525-42620547 ACTTAGAATTAGAAATTAGAAGG - Intergenic
1084730215 11:71068190-71068212 ATCTACAAGTAGAAAGAGGAAGG + Intronic
1085472191 11:76765541-76765563 ATGAAGGAGTAGGAATTGGCTGG - Intergenic
1085629191 11:78099134-78099156 AAGTAGAAGATGAATTTGGATGG - Intergenic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1086286069 11:85253199-85253221 ATGTGGAAGTAAAAATTAAATGG + Intronic
1086517998 11:87636318-87636340 ATGTAGAAGTAGCACTTATAAGG - Intergenic
1086564161 11:88205982-88206004 ATGTAGCAGTGGAGATAGGAGGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087062573 11:93995366-93995388 ATGTAGAATTAAAAAGTGAATGG - Intergenic
1087117005 11:94536192-94536214 ATGTGGAATTATAAATTAGAAGG - Intergenic
1088707450 11:112476713-112476735 AGGTAGCAGTGGAAATAGGAGGG - Intergenic
1090902991 11:131048843-131048865 GTTTTGAAGTAGAAATTAGAGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092067508 12:5604129-5604151 AGGTAGAATTAAAAAGTGGATGG + Intronic
1093177167 12:15925675-15925697 CTGAAGAAGTAGAACTTTGAAGG + Intronic
1093543007 12:20310167-20310189 ATTTAGAAATAAAATTTGGAGGG + Intergenic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1094378476 12:29817188-29817210 ATCTGAAAGAAGAAATTGGAAGG + Intergenic
1095339359 12:41070106-41070128 ATGGAGCCGCAGAAATTGGAAGG - Exonic
1095408249 12:41891785-41891807 AAGCAGCAGTAGGAATTGGAGGG + Intergenic
1096138047 12:49219194-49219216 TTAAAGAAGTAGAAATTGGCCGG + Intronic
1096901915 12:54892089-54892111 ATGTAGCAGTGTAAAATGGAAGG + Intergenic
1097300663 12:58015168-58015190 ATGAAGAAGTAGCAATGGGCTGG - Intergenic
1098588073 12:72178959-72178981 ATATAGAAGAACAATTTGGAAGG + Intronic
1098641750 12:72847024-72847046 GTTTAGAGGTAGAAATTGGTTGG - Intergenic
1098643045 12:72861643-72861665 AAGTAGAAATAAAAATTGGCAGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1100581785 12:95946290-95946312 ATGTTGAAGGAAAAATTGGTGGG + Intronic
1100972300 12:100083402-100083424 ACATAGAAGTAGAAAGTGAAGGG + Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103804815 12:123564026-123564048 ACCTAGGAGTAGAAATTAGATGG - Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1107631271 13:42344832-42344854 GTGTGGAAATAGAAATGGGAAGG + Intergenic
1107734632 13:43385741-43385763 TTGTAGAAAAAGAAATTGGAAGG + Intronic
1107914212 13:45132750-45132772 ATGTAGAAGTTTAGATTTGATGG + Intronic
1109011387 13:56950682-56950704 TTATAGAATTTGAAATTGGAAGG - Intergenic
1109142321 13:58729753-58729775 AAATAGAAGTAGCAATAGGATGG + Intergenic
1109595773 13:64551700-64551722 ATGTAGAACTAGAGAGTGGGAGG + Intergenic
1110387218 13:74927525-74927547 AGATAGAGGTAGAGATTGGATGG - Intergenic
1110689503 13:78415806-78415828 ATATGGAAGTAGAGAATGGAAGG + Intergenic
1111019105 13:82423288-82423310 ATGTAGAATTTGATATTGGTGGG - Intergenic
1111147742 13:84206432-84206454 ATTTAGAAGTAGAAATATGTTGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1112165577 13:96916569-96916591 AAATAAAAGTAAAAATTGGATGG - Intergenic
1112258641 13:97857756-97857778 ATGCAGATGTAGAAATGAGAGGG - Intergenic
1112425623 13:99296907-99296929 AGGTAGAAGTATAGATTGCATGG - Intronic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1115210092 14:30958689-30958711 CTGAAGAAGTAAAAATTGGTGGG + Intronic
1116143572 14:41033590-41033612 AAGTAAAAGTAAAAATTGGGAGG - Intergenic
1116404395 14:44550630-44550652 AAGTAAAATTAAAAATTGGATGG + Intergenic
1119908425 14:78326536-78326558 ATGTAGAGGAAGTAATTGAAGGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120126002 14:80744290-80744312 ATATATAACTAGGAATTGGAGGG - Intronic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120740991 14:88108783-88108805 AATTAGAAGTGGAAATTGAAAGG - Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1124781687 15:32642159-32642181 TTGCAGAAAAAGAAATTGGAGGG + Intronic
1125089189 15:35770830-35770852 ATGTGGAAATAGATCTTGGAGGG + Intergenic
1126138768 15:45418997-45419019 ATGTATAAACTGAAATTGGAAGG + Intronic
1126240226 15:46433410-46433432 ATTTAGGAGGAAAAATTGGAAGG + Intergenic
1126274102 15:46855965-46855987 ATGAAGAAGTAGAAAATGTAGGG - Intergenic
1126820401 15:52497458-52497480 ATTTAAAAGAAGAAATTGGCTGG + Intronic
1127100957 15:55564465-55564487 ATATAGAATTAGAAAGTAGAGGG + Intronic
1127262578 15:57337043-57337065 ATATAGAAATAGACCTTGGAAGG - Intergenic
1127585955 15:60378147-60378169 ATCAAGAAATAGAAATGGGATGG - Intronic
1128799765 15:70489979-70490001 ATGGATAAGTGGAACTTGGATGG - Intergenic
1129054518 15:72809424-72809446 CTGTGGAAATAGACATTGGAGGG + Intergenic
1129650435 15:77483424-77483446 ATGGAGATGTATAAATTGGTGGG - Exonic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1132316873 15:100896895-100896917 TTGTAGAAGTAGAAATTATCTGG + Intronic
1133313838 16:4869765-4869787 ATCTAGATGGAGAAACTGGAGGG + Intronic
1134529289 16:14970417-14970439 ATGTAGAAGAAGAAATCAAAAGG + Intergenic
1135012110 16:18891003-18891025 CTGTTGAATTAGAATTTGGAGGG - Intronic
1135318966 16:21478227-21478249 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1135371863 16:21910020-21910042 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1135439924 16:22460684-22460706 CTGTTGAATTAGAATTTGGAGGG + Intergenic
1136329271 16:29560297-29560319 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1136443900 16:30300008-30300030 CTGTTGAATTAGAATTTGGAGGG - Intergenic
1136618456 16:31412631-31412653 ATGTAGGAGTGGAGATTGGAAGG - Intronic
1137480909 16:48851266-48851288 AGGCAGAAGAAGAAATTGGTGGG + Intergenic
1137521741 16:49200863-49200885 ATGTAGGAGGAGATATTGGATGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138611210 16:58126281-58126303 ATGTTTAAGTTGAGATTGGAAGG + Intronic
1138837185 16:60452204-60452226 ATGTTGAACTAGAAATTATAAGG + Intergenic
1138871302 16:60890414-60890436 ATATGGAAGTAGAATTTGAAGGG + Intergenic
1139867069 16:70070565-70070587 ATGTAGAAGAAGAAATCAAAAGG - Intergenic
1140713136 16:77696558-77696580 ATATAGAAGTAGATATTTCATGG - Intergenic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1146968638 17:37054412-37054434 ATGTAAAAGTTGAAATTGCTTGG + Intronic
1147557550 17:41489037-41489059 ATGTGGAAGTTGAATTTTGAGGG - Intronic
1149186669 17:54006071-54006093 ATTTAGAAGTAGAAATTTCCAGG + Intergenic
1149187065 17:54010914-54010936 ATGCAAAAGTAGAAATGTGAAGG + Intergenic
1150514070 17:65789250-65789272 ATCTAGAAGTAAAAGTTGGCAGG - Intronic
1153043571 18:836063-836085 TTGTAGAAGTAGAAGATGGGAGG + Intergenic
1153206297 18:2706449-2706471 ATGTAGAAGATGAAATGGCAAGG + Exonic
1153738435 18:8097352-8097374 AGGTAGAAGTAGAGATGAGATGG - Intronic
1155056887 18:22192807-22192829 ATGTACAAATATAAATTGCAAGG - Intronic
1156689472 18:39689827-39689849 ATGTAGGTGTAGAAATTGAATGG - Intergenic
1156738015 18:40286692-40286714 AAGTAGAACTTGAAATAGGAAGG + Intergenic
1156907309 18:42369518-42369540 GTGTGGAGGTAGAAATTGTAGGG + Intergenic
1157199529 18:45647362-45647384 ATGTAAGAGTAGAAATGAGAAGG - Intronic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158613561 18:58965540-58965562 AAGCAGAAGTAAAAACTGGATGG - Intronic
1158824744 18:61204324-61204346 ATATAGAAGTAAACATTGAAAGG - Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159766333 18:72493600-72493622 ATATAGAAGTAGAATTTATAAGG + Intergenic
1159780604 18:72656406-72656428 ATGAAGTTGTAGAAACTGGAAGG - Intergenic
1160644567 19:175447-175469 ATTTAGGAGAAGAAATTGTATGG + Intergenic
1166555625 19:43697854-43697876 ATGTAGAAGGAGGAATTGCAGGG - Intergenic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
925454463 2:4003290-4003312 ATATAGAAGTGGAAAATGCATGG - Intergenic
926710831 2:15879037-15879059 ATGTAGAAGTAAAAATGGGCTGG + Intergenic
928776650 2:34772404-34772426 AGGTAACAGTAGAAATGGGAAGG - Intergenic
928866027 2:35918705-35918727 ATGTAGAAGGAGAAATTTAGTGG + Intergenic
929098213 2:38284158-38284180 ATGTAGAAAATGAAGTTGGAAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929426514 2:41849867-41849889 ATGTATAATTAGAGATTAGAAGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929904336 2:46033059-46033081 ATGTAGAAGCATGAGTTGGATGG + Intronic
932184285 2:69678695-69678717 AAGTAGAAATAGAAATTTGTGGG - Intronic
932603342 2:73145479-73145501 AAGTAGAAGTTTCAATTGGATGG - Intronic
932834833 2:75026630-75026652 ATTTAGAAGTATAAATTGTAGGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933198755 2:79423564-79423586 ATGTAGATATAAAAATTGAATGG + Intronic
933765782 2:85707815-85707837 ATGTGGAAAGAGAAATTGTATGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
941138814 2:161751079-161751101 ATGTATAAGTGGAAATTGAAAGG - Intronic
941480031 2:165996175-165996197 ATGTTAAAATAGAAAATGGATGG + Intronic
942663415 2:178290141-178290163 ATGTAGAAGGAATAATAGGATGG - Intronic
943202145 2:184842080-184842102 ATTTACAACTAAAAATTGGATGG - Intronic
943436145 2:187867801-187867823 ATGTAGCTGTAGAACTTGGGAGG - Intergenic
943593328 2:189825772-189825794 ATATAGAAGTGGGAATAGGAAGG - Intronic
945136536 2:206634908-206634930 ATGTTGAAGTAGAAATTTAATGG + Intergenic
945274804 2:207977466-207977488 CTGTAGAAGTATAAGTTGTAAGG + Exonic
945441503 2:209885437-209885459 AGATAAAAGAAGAAATTGGAAGG + Intronic
946558342 2:220884656-220884678 AAATAGAAGTAGAAATTTGTAGG - Intergenic
947069324 2:226269105-226269127 AATTAGAAGTAGAACTAGGAAGG - Intergenic
947099410 2:226603742-226603764 ATTTGGAAGTAGCAATTGGGAGG + Intergenic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
1169813799 20:9635426-9635448 ATGGACAAGTAGAGATTGGATGG - Intronic
1172323732 20:34018196-34018218 TTGTAGTAGTAGCCATTGGATGG + Intronic
1173215678 20:41080685-41080707 TTGTTATAGTAGAAATTGGATGG + Intronic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174279462 20:49428256-49428278 AAGCAGAAGTAGAAATTCTATGG + Intronic
1174301012 20:49582348-49582370 CTGTAAAGCTAGAAATTGGAAGG + Intergenic
1174941021 20:54927262-54927284 ATGTTGAAGTAAACATAGGAAGG - Intergenic
1177050033 21:16221508-16221530 ATGCAGTAGTAGAAATTGACAGG - Intergenic
1177686944 21:24449322-24449344 GAGAAGAAGTAGAATTTGGAGGG - Intergenic
1179523488 21:41960444-41960466 ATGTAGAAGTTGAGTTTGTAAGG + Intergenic
1182404667 22:30115797-30115819 ATGAAGAAGGAGGGATTGGATGG + Intronic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1184052624 22:42019416-42019438 AAGTAGAAGTAGAAATTACCCGG - Exonic
949171639 3:1005933-1005955 ATGTAGATGTATATATTTGAAGG - Intergenic
949529629 3:4941587-4941609 ATATTGAAGTAGAAATTAAAGGG + Intergenic
949915588 3:8961333-8961355 AGGGAGAAGTAGAAAATGGGTGG + Intronic
950474517 3:13207101-13207123 ATGCAGTAGTAGAAATTGTCAGG - Intergenic
950975585 3:17239459-17239481 AAGTAGAGGAAGAAATGGGATGG - Intronic
951773902 3:26287412-26287434 GAGTAGAAATAGAAATAGGAGGG + Intergenic
952119924 3:30230191-30230213 ATGAATAAGTTGAAATGGGAAGG - Intergenic
952193617 3:31049348-31049370 ATGTACAAGTTGAATTTGGGTGG + Intergenic
952690550 3:36200182-36200204 ATGTTCAAGAAGAAATTGAAGGG - Intergenic
956136998 3:66109273-66109295 ATCTGGAAGTAGAAATTAGGTGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956980578 3:74632536-74632558 GTGAAGAAGTAGAAATGAGAAGG - Intergenic
957404720 3:79762842-79762864 AAGTGGAAGTAAGAATTGGAGGG + Intronic
957518955 3:81294379-81294401 ATGTTGCAGGAGAAATTGGGAGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958681592 3:97338953-97338975 ATATAGTAGTAGAGATTGGATGG - Intronic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
960090569 3:113634310-113634332 TTCTATAAATAGAAATTGGAAGG - Intergenic
964174598 3:153810894-153810916 AAATAGAACTAGAAATTGCAGGG + Intergenic
964236693 3:154538607-154538629 ATGTAGAAGTCCAGATTTGATGG + Intergenic
964857752 3:161165355-161165377 CTGTGGACGTAGAAATGGGAAGG - Intronic
965153964 3:165021492-165021514 ATGTAGAATTAGAAATTATGTGG - Intronic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
966789979 3:183658653-183658675 TTGTTGAAGTATAAATTGAAAGG - Intronic
966992809 3:185251690-185251712 ATATAAAATTAGAAATAGGAAGG + Intronic
967612235 3:191521000-191521022 TTCTAGAAGAAGAAAATGGAAGG + Intergenic
969133243 4:5007993-5008015 ATCTAGAAGAATAAATTGTATGG - Intergenic
970976761 4:22050682-22050704 TTGTAGAGGTGGAAATTGAAAGG + Intergenic
971643932 4:29171843-29171865 ATATAGAAGGAGAACTTAGAAGG - Intergenic
972436696 4:39042176-39042198 ATTTAAAAGTAGAATTTGGCCGG - Intergenic
974177890 4:58347441-58347463 ATGCAGAAGTAGTAAATGCAAGG + Intergenic
974847422 4:67367680-67367702 ATGCAGAAGTAGAAATTCAGAGG + Intergenic
975356883 4:73417180-73417202 AGATACAAGTAGAAAATGGAAGG - Intronic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976849003 4:89523766-89523788 ATGTATAATTAGAAATTTGCAGG - Intergenic
977242773 4:94593135-94593157 GTGTAATAGTATAAATTGGAAGG + Intronic
977362630 4:96025546-96025568 ATTTAGAAAAAGAAATGGGAAGG - Intergenic
977689961 4:99894781-99894803 TTGTAGATGAAGAAATTTGAGGG + Intergenic
977869187 4:102069965-102069987 TTGTAGAAGTAGAAATTCTTAGG + Intronic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978529250 4:109697822-109697844 ATGTTGACCTAGAACTTGGAGGG - Intronic
978541239 4:109818379-109818401 ATGTAGAATTAGAAGTTGTTTGG + Intronic
978568808 4:110113810-110113832 ATGTAGAAATAGAATTCAGAAGG + Intronic
979261791 4:118656216-118656238 ATTTAGGAGAAGAAATTGTATGG - Intergenic
979629864 4:122888273-122888295 AGGTAGCAGTAGAAATGGTAAGG - Intronic
980276992 4:130665665-130665687 ATGAAGAATGACAAATTGGAAGG - Intergenic
980566132 4:134545263-134545285 CTGTGGGAATAGAAATTGGAAGG - Intergenic
980697653 4:136380950-136380972 ATGTATAAGCAGAAATTTGTAGG + Intergenic
981398033 4:144277572-144277594 ATTTAGAAGAAGAGATTAGATGG - Intergenic
981401721 4:144321599-144321621 ATGTAGATGAAGAAATTCAAGGG - Intergenic
981451596 4:144904623-144904645 GTGTAGAAATTGGAATTGGAAGG - Intergenic
981635961 4:146879339-146879361 AGTTGGAAATAGAAATTGGATGG - Intronic
982156337 4:152525217-152525239 GTGTAAATGTAGAAATTAGATGG - Intronic
982413247 4:155103347-155103369 ATGTAAAAGCAGGGATTGGAGGG - Intergenic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
983150037 4:164267109-164267131 ATTTAGGAGAAGAAATTGTATGG + Intronic
985126888 4:186703305-186703327 TTGTAGAAGTAGAAATTCTATGG - Intronic
986521486 5:8623364-8623386 GTGAAGGAGTAGATATTGGAAGG - Intergenic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
987917360 5:24231617-24231639 CTGTAGAATTAGGAATTGTACGG - Intergenic
989237040 5:39160021-39160043 ATATAGAAGTAGCAAATGTAGGG - Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989414261 5:41155220-41155242 TTTTAGAAGTAGAAATTGAGAGG - Intronic
989669471 5:43898223-43898245 ATGTAGAAAGTGAAATGGGATGG + Intergenic
990019564 5:51108262-51108284 ATAGAGGACTAGAAATTGGAAGG - Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990836949 5:60032350-60032372 ATAGAGAAGTAGAAGTTGTATGG - Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991622725 5:68562228-68562250 ATGAAGGAGTAGTAATTGCATGG + Intergenic
993234757 5:85290173-85290195 AGATAGAAGTAGAGATTGAAAGG + Intergenic
993465586 5:88242228-88242250 ATGCTGAAGTAGAAATCAGATGG - Intronic
993954781 5:94218803-94218825 ATGGAGAACAAGAAATTTGATGG - Intronic
994558480 5:101334813-101334835 ATGTATAAGTGGCAATTGAATGG - Intergenic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
995195440 5:109361736-109361758 AGGTAGAAATACAAATTGCATGG + Intronic
995886293 5:116898110-116898132 ATGTAGCAATAGAAATTTGAAGG + Intergenic
996295126 5:121904534-121904556 ATGTAAAAATATACATTGGAAGG + Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
996998692 5:129731324-129731346 AGGTAGAAATAGAAATTGCATGG + Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998087570 5:139339192-139339214 AGGTTGAAGTAGAAATCAGAAGG - Intergenic
998795530 5:145814327-145814349 ATGTAGAAATAGCAAAAGGATGG - Intronic
998873682 5:146577514-146577536 ATGTAAATGGAAAAATTGGATGG + Intergenic
1000050308 5:157557231-157557253 ATGAAGAAGTAAAACTTAGAAGG + Intronic
1000862511 5:166473356-166473378 AGAAAGAAGTAGAAATTGGAGGG + Intergenic
1002732357 5:181349332-181349354 ATTTAGGAGAAGAAATTGTATGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1004451533 6:15752530-15752552 GAACAGAAGTAGAAATTGGAGGG - Intergenic
1005563143 6:27061939-27061961 ATGTAGAAGTATTAATAGGTGGG - Intergenic
1005692924 6:28324298-28324320 ATGTAGAGGTTGCAAGTGGAAGG + Intergenic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1006330383 6:33386159-33386181 AGGTAGAGATAGAAATAGGAGGG - Intergenic
1008043556 6:46828760-46828782 ATGTAAAGGAAGGAATTGGAAGG - Intronic
1009642649 6:66358052-66358074 ATGTATATGTAGAATTTGAATGG + Intergenic
1010170987 6:72975036-72975058 ATGTAAAAGTAGAAAGTGTTAGG - Intronic
1010186927 6:73155662-73155684 ATGTACAGGAAGAGATTGGAAGG + Intronic
1010234139 6:73561108-73561130 AAATAGGATTAGAAATTGGAAGG - Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1012101991 6:95101574-95101596 ATGTAAAAGTATAAATTGTGGGG - Intergenic
1012634941 6:101526319-101526341 TTTTAAAAATAGAAATTGGATGG + Intronic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015701916 6:136045746-136045768 ATGTGGTAGTAGAAATTGAAAGG + Intronic
1016624908 6:146155741-146155763 ATGAAGTTGGAGAAATTGGAAGG - Intronic
1016989481 6:149919461-149919483 ATGTAAAAATACAAATAGGAAGG - Intronic
1017630263 6:156390011-156390033 ATGTAAAGGTAGAAAGTAGAAGG + Intergenic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018657927 6:166057750-166057772 AAGTGGAAGGAGAAATTGAAAGG - Intergenic
1018950797 6:168377627-168377649 AAGTAGAAGAGGAAATCGGAAGG - Intergenic
1019236608 6:170621648-170621670 ATTTAGGAGAAGAAATTGTATGG - Intergenic
1019857473 7:3623885-3623907 ATATAAAAATAGAAATTTGATGG + Intronic
1020588815 7:10107770-10107792 ATATGGAATTAGAAAATGGATGG - Intergenic
1020755768 7:12201354-12201376 AGGTAGAGGTAGAAATTGACAGG - Intergenic
1021682517 7:23148645-23148667 ATGAAGAAATAGAAATTCTAAGG - Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023260318 7:38351941-38351963 ATGTAACATTAGAAATTGGGCGG - Intergenic
1023260828 7:38356771-38356793 ATGTAACATTAGAAATTGGGGGG - Intergenic
1023261809 7:38365895-38365917 ATGTAACATTAGAAATTGGGGGG - Intergenic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1026484314 7:70804848-70804870 ATGTATACTTAGAAATGGGATGG - Intergenic
1027299651 7:76817952-76817974 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
1027473953 7:78606906-78606928 ATTTAAAATTAGAAATTGGGAGG - Intronic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028744536 7:94312385-94312407 ATGGTGAAGTAGAAAATAGAAGG - Intergenic
1028982833 7:96985600-96985622 ATGCAGAAGTAGAAACTAAAAGG + Intergenic
1029316049 7:99715167-99715189 AAGTTGAAGTAGAAATTAAAAGG + Intronic
1030543953 7:110869229-110869251 ATTTTTAATTAGAAATTGGATGG - Intronic
1031839704 7:126723124-126723146 AGGAAGAGGTAGAAATTGAAGGG + Intronic
1031901609 7:127417495-127417517 AAGTAGAAATAGAAAATGAAAGG - Intronic
1032482477 7:132257855-132257877 CTGTAGATGGAGGAATTGGAAGG + Intronic
1035333062 7:158108666-158108688 TTCTAGAAGTAGAAATCTGAAGG - Intronic
1035511163 8:184960-184982 ATTTAGGAGAAGAAATTGTATGG + Intergenic
1036392209 8:8333289-8333311 ATGCAGAATTGGAAATTCGAAGG - Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038375564 8:27036874-27036896 ATGAAGAAGAAGAAATTATATGG + Intergenic
1038756886 8:30350097-30350119 ATCTACAAGGAGAAATTTGAAGG - Intergenic
1039008568 8:33068393-33068415 ATGGAGAAATAGAAATTAGTAGG + Intergenic
1039142201 8:34402711-34402733 CTGCAGTAGTAGAAACTGGAAGG - Intergenic
1039193786 8:35007088-35007110 ATGTAAAGGTAGAAATGGCAGGG + Intergenic
1039357416 8:36835954-36835976 AGGTAAAAATAGAAATTTGATGG - Intronic
1039411374 8:37357955-37357977 AAGTAGGAGAAGAAATGGGAAGG - Intergenic
1039648869 8:39318750-39318772 AAGTATAAGTGGAATTTGGAAGG - Intergenic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1040776844 8:51055157-51055179 ATGTAGAGGCAGGAATTGTATGG + Intergenic
1041062403 8:54048327-54048349 ATGCAGAACTAGATACTGGATGG - Intronic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1042867535 8:73368887-73368909 AGGCATAAGTAGAGATTGGAGGG + Intergenic
1043237711 8:77889681-77889703 ATCTAAGAGTAGAAATTAGATGG - Intergenic
1043467846 8:80530495-80530517 ATGTAACAGTGGAGATTGGAAGG + Intergenic
1044050005 8:87489381-87489403 ATGTAGAAGAAAAAATTGAAAGG + Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1044928366 8:97228533-97228555 ATGGATAACTAGAAGTTGGAAGG - Intergenic
1045734132 8:105275392-105275414 ATGTAGGAGTGGAAAGTGGGTGG - Intronic
1045959290 8:107948355-107948377 AGGTTGAAAGAGAAATTGGAAGG + Intronic
1045983053 8:108215072-108215094 AAGTAGACTTAGAAATTAGAAGG + Intronic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1050451859 9:5790069-5790091 ATGTTGTAATAAAAATTGGATGG + Intronic
1050697839 9:8298837-8298859 ATGTACCAGTAGAAGTTGGTTGG - Intergenic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051168215 9:14288760-14288782 ATTTACAAGTAGAAATGAGAGGG - Intronic
1052677811 9:31649545-31649567 ATATAGACTCAGAAATTGGATGG - Intergenic
1053522643 9:38796626-38796648 ATATAAAATTAGAAATTGAAGGG - Intergenic
1054942774 9:70761596-70761618 ATGAAGAAGAAGGAATTGGTAGG - Exonic
1055211368 9:73798110-73798132 AAGAAGAAGTAGAAATTGAAAGG - Intergenic
1055601889 9:77928027-77928049 AAGTAGAACTAGAAATTTTAAGG + Intronic
1055610740 9:78021546-78021568 ATTTAGAATTAAACATTGGATGG - Intronic
1055859800 9:80735002-80735024 ATTTAAAGGTATAAATTGGAAGG - Intergenic
1056388368 9:86117943-86117965 ATGTAAAAATAGCAATTGCAGGG + Intergenic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1062756759 9:138301659-138301681 ATTTAGGAGAAGAAATTGTATGG - Intergenic
1185882262 X:3751880-3751902 ATGTAGATGTAGGAATTGTTGGG + Intergenic
1186311238 X:8322084-8322106 TTCTAGAAGTAGAAAGTAGATGG + Intergenic
1186352461 X:8754259-8754281 ATGTAGATGGAGAAATCAGAGGG - Intergenic
1186954119 X:14661573-14661595 ATTTAAAAGTAGAAAATGGCTGG + Intronic
1188294754 X:28433636-28433658 ATGTAAATGCAGAAATTGGGTGG - Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189880128 X:45482287-45482309 ATGTAGGAGAAGAGATTGGTAGG + Intergenic
1190129858 X:47737719-47737741 ATGTAGGAGTAAAAATATGAAGG + Intergenic
1190278204 X:48912682-48912704 GTGTTGAAGGAGAAATTAGAGGG + Intergenic
1190412313 X:50149033-50149055 ATAAAGAAGTAGAAATTATAAGG + Intergenic
1190827011 X:54026898-54026920 GTGTAGAAGTAGGAAGTGGCTGG - Intronic
1194184227 X:90752762-90752784 AAGTAGTAGTAGAAAGTGGAGGG + Intergenic
1194514376 X:94832917-94832939 AGATAAAAGTAGAATTTGGATGG + Intergenic
1194530372 X:95040482-95040504 ATATAGAAGAAGATATGGGAAGG - Intergenic
1195589466 X:106607771-106607793 AAATAGAAGTAGGATTTGGATGG + Intergenic
1196000055 X:110773426-110773448 GTGTAGAAGTATATATTGTAGGG + Intronic
1196848194 X:119913464-119913486 ATGTACATGTAGACATTGAAGGG + Intronic
1197258661 X:124292309-124292331 ATGAGGAAGTTGTAATTGGAAGG - Intronic
1198804652 X:140481683-140481705 AGGTAGGAGTAGAAATGGGAAGG + Intergenic
1199006289 X:142700998-142701020 ATGCAGAAGTTGAAATTAAAGGG + Intergenic
1199706066 X:150426472-150426494 ATGGAGAAGAAGCAATCGGAAGG - Intronic
1199871989 X:151906497-151906519 ATGTTTAAATAGAAATTGGGAGG + Intergenic
1200127551 X:153823646-153823668 ATTAAGAAGTGGAAATTGGCTGG - Intronic
1200756562 Y:6995550-6995572 ATGCAGAAGTAGAAATTAACTGG + Intronic
1202383881 Y:24304679-24304701 ATTTAGGAGAAGAAATTGTATGG - Intergenic
1202486902 Y:25365441-25365463 ATTTAGGAGAAGAAATTGTATGG + Intergenic