ID: 990265677

View in Genome Browser
Species Human (GRCh38)
Location 5:54072350-54072372
Sequence GTTTATCCACAGCTGCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990265677_990265680 1 Left 990265677 5:54072350-54072372 CCTAATTGCAGCTGTGGATAAAC 0: 1
1: 0
2: 1
3: 15
4: 170
Right 990265680 5:54072374-54072396 CAAACAAGGACACACATGGTTGG No data
990265677_990265679 -3 Left 990265677 5:54072350-54072372 CCTAATTGCAGCTGTGGATAAAC 0: 1
1: 0
2: 1
3: 15
4: 170
Right 990265679 5:54072370-54072392 AACACAAACAAGGACACACATGG No data
990265677_990265683 29 Left 990265677 5:54072350-54072372 CCTAATTGCAGCTGTGGATAAAC 0: 1
1: 0
2: 1
3: 15
4: 170
Right 990265683 5:54072402-54072424 CCCCTGTCTAGACTTGATGGTGG No data
990265677_990265681 26 Left 990265677 5:54072350-54072372 CCTAATTGCAGCTGTGGATAAAC 0: 1
1: 0
2: 1
3: 15
4: 170
Right 990265681 5:54072399-54072421 ATACCCCTGTCTAGACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990265677 Original CRISPR GTTTATCCACAGCTGCAATT AGG (reversed) Intronic
900154744 1:1199394-1199416 GTTAATCCACACCTGCTCTTAGG + Intergenic
902102919 1:14008195-14008217 TTTTATCCCCAGATGCATTTAGG - Intergenic
902104636 1:14024200-14024222 GTTTATCAACAGCCACAAATTGG + Intergenic
908496381 1:64699106-64699128 GTTTCTCCAAAGCTGCCCTTAGG + Intergenic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
914851678 1:151319058-151319080 ATTTATCCTCAACTGCAAATTGG + Intronic
917238941 1:172926116-172926138 CTTTATCCATATCTGCAATAAGG + Intergenic
917857548 1:179113496-179113518 GTTCAAACACAACTGCAATTAGG + Intronic
919372284 1:196742888-196742910 ATTTTTCCACATCTCCAATTTGG + Intronic
920876125 1:209837559-209837581 GGTTGTCCACAGCTGTAATATGG - Intronic
923205151 1:231752145-231752167 CTTTAGCCATACCTGCAATTTGG + Intronic
924140769 1:241020889-241020911 TTTTATCCACAAAAGCAATTTGG + Intronic
1063039700 10:2324550-2324572 GTTTCTCCACATCAGCAATTAGG + Intergenic
1065919417 10:30379111-30379133 GATTCTCAACAGCTGCCATTTGG - Intergenic
1067562797 10:47315524-47315546 GTTTTTCTGCAGCTCCAATTGGG - Intergenic
1068746887 10:60542516-60542538 TTTTATCCACATCTGCTATAAGG - Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1072973375 10:100036958-100036980 TTTTATCCTCAGGAGCAATTTGG - Intergenic
1073568482 10:104556042-104556064 GTTTGTCCCCTGCTGCCATTGGG + Intergenic
1073853694 10:107650871-107650893 GTTTGTCCCCAGCTGAAAGTTGG + Intergenic
1074379779 10:112969805-112969827 GTTTACACACATCTGCAATGTGG - Intronic
1074844871 10:117388903-117388925 GTTTTTCTACAGCTGCCCTTAGG + Intergenic
1076497531 10:130906726-130906748 GTCCATCCACAGCTGGAACTTGG - Intergenic
1077887141 11:6394661-6394683 GTTGAACCACAGCAGCATTTGGG - Exonic
1079961154 11:26925429-26925451 GTCTATCCAGTGCTGCAAGTGGG + Intergenic
1081735019 11:45396644-45396666 CTTTATCCAGAGCAGCAATGTGG - Intergenic
1084398717 11:68931492-68931514 GCAGATCCACAGCTGCAGTTTGG + Intronic
1086912772 11:92492170-92492192 GTTTTAACACAGCTTCAATTTGG + Intronic
1087715340 11:101602273-101602295 TTTTATCCCCAGGAGCAATTTGG - Intronic
1088227342 11:107635687-107635709 GTTTTTCCACATCTGCAATAAGG - Exonic
1089701868 11:120249622-120249644 GGTTAGCCACATCTGCACTTGGG - Intronic
1092183421 12:6461668-6461690 GTTGCACCTCAGCTGCAATTAGG + Intronic
1093002718 12:14016096-14016118 ATTTATTCACAGCTCCAATATGG + Intergenic
1093255548 12:16862744-16862766 GTTTATTCACAGCTGGAAGTAGG - Intergenic
1093543607 12:20318506-20318528 GTTTATCCAGAGCTTAAATTTGG + Intergenic
1093647117 12:21599655-21599677 GCTTATCCACATCAGTAATTAGG + Intronic
1094164471 12:27428118-27428140 TGTTATCCACAGGAGCAATTGGG + Intergenic
1094427185 12:30327964-30327986 TTGGATCCACAGCTGCAATTTGG - Intergenic
1094454547 12:30617903-30617925 ATTCAGCCACAGCTGCAAATGGG + Intergenic
1098184731 12:67884015-67884037 GCTTATCCTCAGCTGTAATCTGG + Intergenic
1100089371 12:90952069-90952091 GGTTATTCACCACTGCAATTTGG + Intronic
1100407487 12:94284160-94284182 TTTTATCCCCAGGAGCAATTTGG + Intronic
1101880014 12:108619819-108619841 TGTTATCCACAGGAGCAATTTGG - Intergenic
1102649095 12:114424581-114424603 AGTTATCCACAGCAGAAATTTGG - Intergenic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1109804148 13:67416119-67416141 GTTTTTTCACACCTGCCATTTGG - Intergenic
1111146294 13:84185213-84185235 GTTTATCCATAGCAACAATAAGG + Intergenic
1111574223 13:90129839-90129861 GTTTGAACACAGCTGCAATTGGG + Intergenic
1112086009 13:96033537-96033559 GTTGGTCCACAGCTGCAGCTGGG - Intronic
1112902941 13:104381001-104381023 TTTTATCCACAGCTGCTGTGTGG - Intergenic
1113103784 13:106750400-106750422 TTTTATCCACAGGAGCAATTGGG + Intergenic
1115335782 14:32243366-32243388 GCTTTTCCACAGCTTCACTTGGG + Intergenic
1117326440 14:54673254-54673276 GTTTGTCCAGAGCTAGAATTTGG + Intronic
1117898938 14:60514061-60514083 GGTTATTCACAGAGGCAATTAGG - Intronic
1118133534 14:62995478-62995500 GTTTATCCAATGTTGAAATTTGG - Intronic
1119028723 14:71174915-71174937 GGTTATCCTCAGGAGCAATTTGG - Intergenic
1119136264 14:72223696-72223718 GTTTACCCAGAGATGCAATGGGG + Intronic
1120795502 14:88628048-88628070 GTTTTTCCAAAAGTGCAATTTGG - Intronic
1124438960 15:29673575-29673597 GTTTATTCTCAGGAGCAATTTGG + Intergenic
1125040753 15:35184669-35184691 GTTTATCTTCAGATGCAACTAGG + Intergenic
1127298518 15:57630663-57630685 GTCTATCCACAGTTTAAATTTGG - Intronic
1129036231 15:72650131-72650153 GATTCTCAACAGCTGCCATTTGG + Intergenic
1129213658 15:74087093-74087115 GATTCTCAACAGCTGCCATTTGG - Intergenic
1129377157 15:75140997-75141019 TATTATCCACAGGAGCAATTTGG - Intergenic
1129396743 15:75253992-75254014 GATTCTCAACAGCTGCCATTTGG + Intergenic
1129400355 15:75278269-75278291 GATTCTCAACAGCTGCCATTTGG + Intronic
1129730795 15:77931417-77931439 GATTCTCAACAGCTGCCATTTGG - Intergenic
1131187442 15:90286983-90287005 GATTCTCAACAGCTGCCATTTGG + Intronic
1132456128 16:24122-24144 GATTCTCCACGGCTGCCATTAGG + Intergenic
1133376592 16:5292457-5292479 GTTAATCCACAGCTCCAGTCTGG + Intergenic
1133508633 16:6436444-6436466 GTTTTACAACAACTGCAATTTGG - Intronic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1138940180 16:61781050-61781072 GTTCATGCACAGGTGCATTTTGG - Intronic
1141082732 16:81067044-81067066 GTTTATCCAAACATGCACTTTGG - Intronic
1141748253 16:85940727-85940749 GCTAATCCACAGCTGCCCTTTGG - Intergenic
1147278710 17:39339500-39339522 TTTTATCCACAGCTTCAACAGGG - Intronic
1149586077 17:57787880-57787902 GTTCCTCCACAGCAGAAATTTGG - Intergenic
1153232599 18:2954114-2954136 GTTTATCCACATGTGCCCTTTGG - Intronic
1153406470 18:4746439-4746461 CTTTCTCCACAGCAGCAATAAGG + Intergenic
1156816259 18:41315209-41315231 GTTTATCTATAGGAGCAATTGGG - Intergenic
1157728655 18:49984969-49984991 CTTTATCCACAACGGCAAATGGG + Intronic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1159607328 18:70488343-70488365 GTTTATCAACAGCTTCACTCTGG - Intergenic
1159925729 18:74267771-74267793 GTGGATCCACAGCTTCCATTTGG - Intronic
1162293675 19:9797936-9797958 TTTTATCCCCAGGAGCAATTTGG - Intergenic
1163323979 19:16591466-16591488 TTTTTTCCAAAGCTACAATTAGG - Intronic
1165474717 19:36023962-36023984 GCTCCTCCACATCTGCAATTTGG + Intronic
927840033 2:26435172-26435194 GCTTCTCCACAGCTGCTTTTGGG - Intronic
929633228 2:43488029-43488051 GTTTTTCCTCATCTGCTATTTGG + Intronic
932358093 2:71083191-71083213 GATTCTCAACAGCTGCCATTTGG + Intergenic
932370432 2:71182758-71182780 GATTCTCAACAGCTGCCATTTGG + Exonic
932783496 2:74579006-74579028 GTTTAGGCACAGCTGGAATGAGG - Intronic
933184108 2:79259734-79259756 TTTTAACCACAGCTGCAGTCAGG + Intronic
936834809 2:116696259-116696281 GGTAATCCTCAGCTGCAATAAGG + Intergenic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
941354838 2:164477914-164477936 GTTTACCCACAGATATAATTGGG + Intergenic
945983213 2:216332711-216332733 GTTAATCCATAGATGCATTTGGG - Intronic
947045837 2:225982344-225982366 GTTATTCCACAGGAGCAATTTGG + Intergenic
1170936276 20:20812616-20812638 GGTTATCCTCAGGAGCAATTTGG + Intergenic
1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG + Intergenic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1175365340 20:58450520-58450542 ATTTATCAACTGCTGCCATTTGG + Exonic
1181784907 22:25220042-25220064 TTTCCTCCACATCTGCAATTAGG + Intronic
1185108694 22:48888713-48888735 TTGTTTCCACAGCTGCAATCAGG - Intergenic
949143390 3:663893-663915 GTGTATGCACAGCTGCTATAAGG - Intergenic
949347601 3:3090969-3090991 CTTCATCCATAGCTGCCATTGGG + Intronic
951246379 3:20346268-20346290 GTATATAAGCAGCTGCAATTAGG + Intergenic
951246380 3:20346382-20346404 GTATATAAGCAGCTGCAATTAGG - Intergenic
956356638 3:68400899-68400921 GTTCATCCACAGCTGTGAATAGG + Intronic
957437192 3:80193777-80193799 CTTTTTCCACATCAGCAATTGGG - Intergenic
957567941 3:81908538-81908560 GTTTCTCCACAGATGCTCTTTGG + Intergenic
958254826 3:91313559-91313581 GTTGAACCACAGCTGTAATTTGG - Intergenic
959337764 3:105087636-105087658 TTTTAGTCATAGCTGCAATTGGG - Intergenic
959340561 3:105124710-105124732 GTTTATCCACCTCTAGAATTTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960262407 3:115582594-115582616 TGTTATCCACAGGAGCAATTTGG - Intergenic
972559917 4:40217899-40217921 GGTTACCCACAGCTCCAATATGG - Intronic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
980878813 4:138688627-138688649 GTTTAAAGGCAGCTGCAATTAGG + Intergenic
980889905 4:138803887-138803909 TTTTATCTTTAGCTGCAATTTGG - Intergenic
986440052 5:7772934-7772956 CTTTATCTACAGCTGCATTCTGG + Exonic
987240498 5:15993633-15993655 GGTTATGCACAGCTGCAAGTAGG - Intergenic
988436674 5:31183394-31183416 GTTTATCTACAAATGCATTTAGG - Intergenic
988835526 5:35028690-35028712 TTTTATCCACACCTGTTATTTGG + Intronic
989084556 5:37661844-37661866 TTTTATCCCCAGGAGCAATTTGG + Intronic
989227593 5:39048111-39048133 GATTGTCCACAGCTACACTTTGG - Intronic
990265677 5:54072350-54072372 GTTTATCCACAGCTGCAATTAGG - Intronic
992767812 5:80018164-80018186 GTTTTTCCAGAGCTCCAATTAGG + Intronic
995651061 5:114368838-114368860 GTTTATCCTCAGCAGCAGTAGGG + Intronic
996568496 5:124907184-124907206 GTTACTACACAGTTGCAATTTGG - Intergenic
998594783 5:143517165-143517187 TTTTAACCACTGCTGCAAATGGG + Intergenic
998744876 5:145247019-145247041 TATTATCCACAGGAGCAATTTGG - Intergenic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1003923444 6:10855459-10855481 TCTGATCCACAGCTGCAGTTTGG - Intronic
1003949615 6:11105569-11105591 GCTTTTCCACAGCTTCACTTGGG + Exonic
1004399161 6:15272570-15272592 TTGTTTCCACAGCTGCAATTTGG - Intronic
1005143671 6:22663179-22663201 GTTTTTCCACTGCTACGATTTGG - Intergenic
1007193426 6:40039146-40039168 GTCTTTCCCCAGCTGCAAATGGG - Intergenic
1008334394 6:50283479-50283501 GTTTATTCAGAGCTAAAATTTGG - Intergenic
1009000533 6:57707518-57707540 GTTGAACCACAGCTGTAATTTGG + Intergenic
1009189000 6:60606945-60606967 GTTGAACCACAGCTGTAATTTGG + Intergenic
1010843615 6:80678224-80678246 TTTTATCCCCAGGAGCAATTTGG + Intergenic
1014735536 6:125091649-125091671 TTTTATCTATAGCTCCAATTAGG + Exonic
1016164015 6:140917347-140917369 GTTTATCCCCAGGAACAATTTGG - Intergenic
1016790504 6:148062541-148062563 CTTGATCCAGAGCTGCATTTAGG + Intergenic
1017572198 6:155757922-155757944 GTTTATCCAGTGCTCCCATTTGG - Intergenic
1020920547 7:14258459-14258481 ATTTATAAACAGCTGAAATTAGG + Intronic
1023225564 7:37965413-37965435 GTTTATCCTCAGCTACAACTGGG - Intronic
1026841685 7:73672786-73672808 GTTTCTCCAAAGGTGCCATTTGG - Intergenic
1027776085 7:82466011-82466033 GTTTATTTCCAGCTGCCATTTGG - Intergenic
1028994256 7:97082867-97082889 GTATTTCCACACCTTCAATTGGG - Intergenic
1029332124 7:99867189-99867211 TTTTATCCACAGCTGCAGAATGG + Intergenic
1031648223 7:124253438-124253460 GTTTAGCCTCAGCTGTAATGCGG - Intergenic
1032000144 7:128260005-128260027 GTTTACCCCCAGGAGCAATTTGG + Intergenic
1032166036 7:129545698-129545720 TTTTCTCCTCACCTGCAATTAGG + Intergenic
1033285153 7:140035134-140035156 GTTTATGCTCAACTGCAATAAGG - Intronic
1035450850 7:158976086-158976108 TCATATCCACAGCTGCAGTTTGG - Intergenic
1036004911 8:4651187-4651209 GTTTATACACATCTGATATTAGG - Intronic
1036675190 8:10825777-10825799 GTTTTTTCACAGCTGAAAGTTGG - Intronic
1036900172 8:12664536-12664558 GCTTATCCACAGAAGCACTTAGG - Intergenic
1036910273 8:12753457-12753479 GTTTATCAACAGTGGCACTTGGG + Intronic
1043417490 8:80066066-80066088 GTTCAGCCACAGCAGCAATGTGG + Intronic
1043989009 8:86729517-86729539 GTTTATCCACAAATCAAATTAGG - Intronic
1044857401 8:96490647-96490669 GTTTATCCACGGTTGTAATGTGG + Intergenic
1051676591 9:19564600-19564622 GTTTGCCCACAGGTGCATTTGGG + Intronic
1052611049 9:30774115-30774137 GTTAACCCAGAGCTGCAATCTGG - Intergenic
1052612985 9:30800053-30800075 GTTAACCCAGAGCTGCAATCTGG + Intergenic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG + Intergenic
1057803609 9:98205059-98205081 GTTTTTCCACCACTGCAATAAGG - Intronic
1060486810 9:124052733-124052755 GTCTATCCCCAGCTGCAACCTGG - Intergenic
1186606818 X:11100871-11100893 ATTTATTCAAAGCTGGAATTTGG - Intergenic
1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG + Intronic
1188451647 X:30313491-30313513 GTTTGTCCACAACTGCAATTTGG + Intergenic
1191093698 X:56652590-56652612 CTTGATCCACAGCTGCATTTAGG + Intergenic
1193300243 X:79880952-79880974 GAATATCCACAGCTGGACTTGGG + Intergenic
1194297900 X:92149169-92149191 AGTTATCCACAACTGGAATTGGG - Intronic
1195654127 X:107318385-107318407 GTTTATCCACATTTCCTATTTGG + Intergenic
1200400236 X:156015602-156015624 GATTCTCCACGGCTGCCATTAGG - Intergenic
1200615509 Y:5374139-5374161 AGTTATCCACAACTGGAATTGGG - Intronic
1201181669 Y:11353718-11353740 TTTTATCCCCAGGAGCAATTTGG + Intergenic