ID: 990266774

View in Genome Browser
Species Human (GRCh38)
Location 5:54085103-54085125
Sequence TGTCATTTCAGTTCACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990266774_990266776 8 Left 990266774 5:54085103-54085125 CCTTTAGGTGAACTGAAATGACA 0: 1
1: 0
2: 1
3: 13
4: 162
Right 990266776 5:54085134-54085156 ATGTCTTTTCTGTACAGAACAGG 0: 1
1: 1
2: 0
3: 24
4: 306
990266774_990266777 9 Left 990266774 5:54085103-54085125 CCTTTAGGTGAACTGAAATGACA 0: 1
1: 0
2: 1
3: 13
4: 162
Right 990266777 5:54085135-54085157 TGTCTTTTCTGTACAGAACAGGG 0: 1
1: 0
2: 0
3: 24
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990266774 Original CRISPR TGTCATTTCAGTTCACCTAA AGG (reversed) Intronic
902511867 1:16970928-16970950 TGTCTTTTCTGTACACCTTAGGG - Intronic
903892361 1:26578191-26578213 TGTCATTTGAATTTTCCTAAAGG - Intergenic
905231218 1:36515938-36515960 TGTCATTTCAGGTCACCAGATGG + Intergenic
909881532 1:80885678-80885700 AGTCATTTCTGTAAACCTAAAGG + Intergenic
910673392 1:89795306-89795328 TGTCCTTTCCCTTCACCTCATGG + Intronic
911223654 1:95279030-95279052 AATCATTTCAGTTCTCATAAGGG + Intergenic
912177778 1:107181920-107181942 TGGCATTTTTTTTCACCTAAAGG - Intronic
912843373 1:113058961-113058983 TGTCATTTCAGTTCAGCTCCAGG + Intergenic
921274966 1:213510360-213510382 TGTCATTTAAGCTCATCTGATGG + Intergenic
922135364 1:222819989-222820011 TTTCATTTATGTTCACCAAAAGG + Intergenic
922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG + Intergenic
923969986 1:239189556-239189578 TCTTATTTCAGTTCCTCTAAGGG - Intergenic
924198573 1:241637303-241637325 TGCCATTTTAGTTAAACTAAAGG - Intronic
1068319235 10:55389144-55389166 TGACATTTCAGTTTCCCTAAGGG + Intronic
1071180190 10:82975151-82975173 TTTCATTTCACTGGACCTAATGG + Intronic
1072274392 10:93808480-93808502 TGACATTTCAGTGCACCAAATGG + Intergenic
1072880827 10:99227011-99227033 TCTCATTTTATTTCACATAATGG - Intronic
1073336706 10:102714989-102715011 TGTGCTTTCAGCTCACCTCAGGG - Intronic
1074563498 10:114555216-114555238 TGTTATCTCAGTTTACCTTAGGG + Intronic
1077746466 11:4912391-4912413 TGTAATTTCAGTCCCCATAAAGG - Intronic
1077851517 11:6078001-6078023 TGTCATTTCAGTTCCTCAACTGG + Intergenic
1078444550 11:11394492-11394514 TGACATTTCAGTTCATCTCTTGG - Intronic
1078462920 11:11528923-11528945 TGTCATTTCAGATAAGCTGATGG + Intronic
1079550575 11:21692416-21692438 TGTCATTTCAGTTCAGTGATGGG - Intergenic
1081502102 11:43677011-43677033 TGCCTCTTCAGTTCAACTAAAGG - Intronic
1088761275 11:112931052-112931074 TGTACTTTCAGTGCACATAAAGG + Intergenic
1089174534 11:116538851-116538873 TGTCCTTTCACTTCACTTCAGGG + Intergenic
1094188789 12:27675298-27675320 TGTCTTTTCAGTTCAATAAATGG + Intronic
1098928714 12:76383934-76383956 TTTCATTTCAGTGTATCTAAGGG - Intronic
1104323105 12:127770755-127770777 TGTCATTTCAGAGCGGCTAAAGG - Intergenic
1108881469 13:55124111-55124133 TGTAATTTCAATTTCCCTAACGG + Intergenic
1109923350 13:69100568-69100590 TGTCATTTCAGTTTAACATAGGG - Intergenic
1111169381 13:84505231-84505253 TTTCAGTTCATTACACCTAAGGG + Intergenic
1111582865 13:90248202-90248224 TGTCATTTTAATTCACCATAGGG - Intergenic
1113852527 13:113425979-113426001 TGTCCTTTCAGAGCAGCTAAAGG - Intronic
1116673848 14:47879501-47879523 TGTCAATTCAGCTCACCCAAAGG + Intergenic
1116749923 14:48870392-48870414 TGTTATTTCAATTTTCCTAAAGG + Intergenic
1116932469 14:50703674-50703696 TGTTATTTCAGTTGACAAAAGGG + Intergenic
1118542681 14:66846240-66846262 TGTCTTCTCAATTCTCCTAAGGG + Intronic
1118588538 14:67380967-67380989 TGTGAGTTCAGCTAACCTAAAGG + Intronic
1119120687 14:72073606-72073628 AGACATGCCAGTTCACCTAATGG + Intronic
1120399136 14:84006138-84006160 TGTCATTTCATTTCAGCTTCAGG - Intergenic
1125398361 15:39273943-39273965 TGTCATTGCATTTTACATAATGG + Intergenic
1131404925 15:92156399-92156421 TGTCATCTCAGTACAGGTAAGGG - Intronic
1135048568 16:19173790-19173812 TGTGGTTTTAGTTCACCTAGTGG + Intronic
1140686705 16:77440764-77440786 TTTCATTTTAGCTCACCTCAAGG + Intergenic
1141718797 16:85743172-85743194 AGACATTTCAGCTCATCTAAGGG - Intronic
1142720078 17:1770131-1770153 TGACATTTCAGTTCAGCGAGGGG + Intronic
1144445302 17:15321889-15321911 TGTCGTTACAGTTCACCTCTTGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148077403 17:44946716-44946738 TGTCACTTCAGTTCCCTAAAAGG + Intronic
1148498289 17:48068674-48068696 TTTCATTTCAGTGCATCTGATGG + Intergenic
1148915931 17:50978823-50978845 GGTCATGTCACCTCACCTAAAGG + Intronic
1150319587 17:64201440-64201462 TGACATTTAAGCTCACCTTATGG + Intronic
1153091808 18:1355369-1355391 TTTCATGTCAGTTCTCCCAAGGG + Intergenic
1158315424 18:56207171-56207193 TGTCACTTAACTTCACCAAATGG - Intergenic
1159035305 18:63271740-63271762 TAGCATTTCAGTTCAACAAAAGG + Intronic
1159563160 18:70017182-70017204 TGTCATTCCAGTGCACATACTGG - Intronic
1160215916 18:76930947-76930969 TGTCATTTCAGTACAATTTATGG - Intronic
1164335964 19:24321549-24321571 TGTCATTTCAGTTCCTCAACTGG + Intergenic
1164377623 19:27702739-27702761 TGTGAATTCATCTCACCTAATGG - Intergenic
928573628 2:32632488-32632510 TGTATTTTCAGTTCACCTTATGG + Intronic
931867557 2:66428672-66428694 TGTCATTTCCCCTCTCCTAAAGG + Intergenic
932372347 2:71201304-71201326 TGGCATTTTTGTTGACCTAATGG - Intronic
939434012 2:142149852-142149874 TGTTCTTTCAATTCACCTACAGG + Intergenic
939861769 2:147429200-147429222 GGTCAGTTAAGTTCACCTAGTGG + Intergenic
941060637 2:160842810-160842832 TGTCTTTTCTGATCACCTATGGG - Intergenic
942771771 2:179529947-179529969 TCTCATTTCATTTCACCCGAAGG - Intronic
945688135 2:212997726-212997748 TGTCATTTCACCTCACCAGACGG - Intergenic
946814357 2:223561129-223561151 TGTCATGTCATTTCAATTAATGG - Intergenic
1169342587 20:4807813-4807835 TGTAATTTCAGTTCAACTTTGGG - Intronic
1172962217 20:38806954-38806976 TGTGATTGCATTTCACATAAAGG + Intronic
1174090964 20:48047257-48047279 TATCATTTCAGTTCAAGGAAGGG + Intergenic
1179438181 21:41376157-41376179 TGTCATCTCTGCACACCTAATGG + Intronic
1180259407 21:46658321-46658343 AGTGATTTCAGTCCACTTAAAGG + Intronic
1181999717 22:26910540-26910562 TGTGATATCAGTTCACCAACGGG + Intergenic
954486152 3:50853582-50853604 TGTTATTTCATTTCAGATAATGG + Intronic
955651188 3:61195651-61195673 TGTCACTTCAGTTATCCTGATGG - Intronic
956373773 3:68592187-68592209 TGTCATTTGGGTTCAGCCAATGG + Intergenic
958114678 3:89200821-89200843 AGACATGCCAGTTCACCTAACGG - Intronic
958453095 3:94298145-94298167 GGACATTTTAGTTGACCTAATGG + Intergenic
963552537 3:146742683-146742705 TGTCATTGCAGATCAAATAAGGG + Intergenic
964823218 3:160796454-160796476 TTTCTTTTCAGATCACCCAAAGG - Intronic
965119855 3:164540493-164540515 TGGCATTTCACCTCACTTAAAGG - Intergenic
965491869 3:169347637-169347659 GGTCATTTCAATTCATTTAAGGG - Intronic
967143575 3:186586077-186586099 TATAATTTCAGTTGACCTCATGG + Intronic
967667384 3:192189541-192189563 GCTCATTTCACTTCATCTAAAGG - Intronic
969451972 4:7279074-7279096 TGTGATTTCAGTTCTCCCATAGG - Intronic
970017919 4:11533510-11533532 TTTGATTTCAGTTCACCTCCTGG + Intergenic
970695194 4:18668620-18668642 TGTCCTTTCATTCCACCTCAGGG - Intergenic
972038900 4:34564710-34564732 TGTAATTTTAGTCAACCTAACGG - Intergenic
972249068 4:37280434-37280456 GGACATGCCAGTTCACCTAATGG + Intronic
974009590 4:56594682-56594704 TATCAATGCAGTTCACCTCAAGG + Intronic
974595189 4:64004966-64004988 TGTCATTTCTGTTAACTTAATGG - Intergenic
974622444 4:64377320-64377342 TGTGCTTTCAGTACAACTAAAGG - Intronic
976613177 4:87050500-87050522 TGTCCTTTCCTTTCACCTCATGG + Intronic
979503948 4:121473025-121473047 CGTTATTTCAGGTCACCAAATGG + Intergenic
979806198 4:124974502-124974524 TCTTCTATCAGTTCACCTAAAGG + Intergenic
980900201 4:138897652-138897674 TGTTATTTAACTTCACCTAATGG + Intergenic
980907415 4:138961829-138961851 GGTTATTACAGTGCACCTAAGGG + Intergenic
983013462 4:162579613-162579635 TGTCATTCCTGTTCTTCTAAAGG - Intergenic
985220643 4:187700349-187700371 TGTCACTTCACTGCACCAAATGG + Intergenic
988868488 5:35361640-35361662 TGTCATTCCCATTAACCTAATGG + Intergenic
989749168 5:44870652-44870674 TGTCATTTCAGTAGCCCTAGTGG + Intergenic
990204611 5:53415256-53415278 TGTCCTTTCAGTTCATCTTGAGG + Intergenic
990266774 5:54085103-54085125 TGTCATTTCAGTTCACCTAAAGG - Intronic
990609445 5:57442607-57442629 TGTCATTTGAGGACACCTAAAGG + Intergenic
991283832 5:64946859-64946881 TGTCATTACTGTTCTTCTAATGG + Intronic
992559126 5:77932999-77933021 TGTGCATTCAGATCACCTAAGGG - Intergenic
993191562 5:84689430-84689452 AGTCATTTCAGTTAAGATAATGG - Intergenic
993672878 5:90783509-90783531 TGTCACTTCATTTCAAATAAAGG + Intronic
995403938 5:111772671-111772693 TGTGATTGCAGTTCCCATAAAGG - Intronic
995826813 5:116309262-116309284 GGTTATTTCAGTTAACATAATGG + Intronic
996787792 5:127259415-127259437 TGACATTTCAGTGCAACTCAAGG - Intergenic
996883730 5:128331128-128331150 TGTCTTTTCTGCTCAACTAAGGG - Intronic
998397734 5:141829936-141829958 TGTCAGTTCAGTGATCCTAAAGG + Intergenic
998714274 5:144864661-144864683 TGTGAGTTCAGTTTTCCTAATGG - Intergenic
999096392 5:148981590-148981612 AGCCATTCCAGTTCCCCTAATGG - Intronic
1005172487 6:23004305-23004327 TGTAATCTCAGCTCACCCAAAGG + Intergenic
1005212501 6:23483180-23483202 TTTCATTGCATTTCTCCTAATGG + Intergenic
1005660650 6:27995745-27995767 TGTCATTTCTGTTCTTATAAAGG + Intergenic
1006097937 6:31667480-31667502 TAGCATTTCAGTTTTCCTAAAGG - Intronic
1010127659 6:72451950-72451972 TGTGATTTAATTTCATCTAAAGG + Intergenic
1012459216 6:99442279-99442301 TGTCATATCAGAGCGCCTAATGG - Intronic
1013435602 6:110102205-110102227 TGTCATTTCAGTTCTGCTACAGG - Exonic
1016539275 6:145145309-145145331 TGGCCTTGCAGTTCACCTCAAGG - Intergenic
1016719702 6:147281615-147281637 TCTTATTTAAGTTCATCTAATGG + Intronic
1018247381 6:161835852-161835874 GTTCATTGCAGTTCACATAAAGG + Intronic
1019029363 6:168996784-168996806 TTTCATTTCATTTGACCAAATGG - Intergenic
1020799189 7:12712683-12712705 TGTCATTTCATTTCACCTGCTGG - Intergenic
1020831124 7:13096769-13096791 TGATATTTCAGTACACTTAATGG + Intergenic
1021245278 7:18253922-18253944 TGTCATTCCACTTAACTTAAAGG + Intronic
1021680297 7:23124044-23124066 TGTCCTTTCATTAGACCTAAAGG + Intronic
1022652437 7:32289645-32289667 TTTCATTGCAGTTCAACTACAGG - Intronic
1023286137 7:38622492-38622514 GGCCATTGCAGTTCATCTAAGGG - Intronic
1023464380 7:40437644-40437666 TGACAGTTCAGTTCACCTTATGG - Intronic
1024141582 7:46467897-46467919 TTTCATTTCCATTCATCTAAGGG + Intergenic
1027596564 7:80181556-80181578 TGTCAGTTCAGTTAGCCGAATGG + Intronic
1030136639 7:106257985-106258007 TGTCAGTTCAGCTGAGCTAAGGG + Intronic
1030250765 7:107441461-107441483 TGTCATTTTAGTGAACATAAAGG + Intronic
1031310308 7:120188301-120188323 TGTCATTACACTTCAGCGAAAGG + Intergenic
1033619674 7:143050804-143050826 TGGAATTTCAGTTCACTAAAAGG - Intergenic
1035082510 7:156228865-156228887 TGTTATTTTAGTTCTCCTCAGGG - Intergenic
1036929582 8:12942002-12942024 TGTCATTTCTGTTAACCAATGGG - Intergenic
1039067731 8:33623749-33623771 TTTCATTTAAGTTGACATAAAGG + Intergenic
1042078771 8:65026226-65026248 CCTCATGTCAGTTCACCTATAGG - Intergenic
1042907869 8:73791833-73791855 TGTCATTTTAGTTTACTTTATGG + Intronic
1042936609 8:74065690-74065712 TATCATCTCAGTTGTCCTAATGG - Intergenic
1044295863 8:90526574-90526596 TGACATTTCAGTTGGCCAAAAGG - Intergenic
1044485062 8:92742996-92743018 TGACATTCCAGGTCACATAATGG - Intergenic
1044843856 8:96361091-96361113 TGTGTTTTCCGTTCAGCTAATGG - Intergenic
1045181157 8:99784350-99784372 TGTCATTACAGATCACAAAATGG - Exonic
1046520858 8:115323818-115323840 TGTCATTTCATTTCTAGTAAAGG + Intergenic
1047594397 8:126363205-126363227 TATCATATCAGTTCATCTAGAGG - Intergenic
1048992997 8:139772319-139772341 GGTCATTTCACATCACCTCATGG + Intronic
1050643756 9:7696322-7696344 TGTTATTTCACTTAACATAATGG + Intergenic
1051152035 9:14092184-14092206 TGTCATTGCAGAACAGCTAAGGG + Intronic
1051169881 9:14310760-14310782 TGTCAATTTAGTTCAACTAAAGG - Intronic
1054920590 9:70538991-70539013 TCTCATTTAAATTCACCAAAAGG - Intronic
1055235541 9:74118260-74118282 TGTCTTTTCAGTTAACTTTATGG + Intergenic
1055837350 9:80459116-80459138 TTTCATTTCAATTTACCTTATGG + Intergenic
1056376870 9:86023204-86023226 TGAAATTTCAGGACACCTAATGG - Intergenic
1056598887 9:88030473-88030495 AGACACATCAGTTCACCTAATGG - Intergenic
1057412729 9:94831922-94831944 TGTCCAGTCAGTTCACTTAATGG - Intronic
1058003306 9:99889509-99889531 TTTGATTTCAGTTCACTTTATGG + Intergenic
1058882780 9:109299959-109299981 TGTTATTTCTGTTCACCGTAGGG - Intronic
1188995354 X:36878275-36878297 AGTCTTCTCAGTTCACCTCACGG + Intergenic
1195629443 X:107039210-107039232 TTTCATTTGTGTTCACCTCAAGG - Intergenic
1196211916 X:113005297-113005319 TTTCATTCCAGTTCATCTCAAGG + Intergenic
1197265847 X:124369951-124369973 TGTCATTTCAGTTCTCCCAAAGG - Intronic
1197620291 X:128740329-128740351 TGTCATTTTGCTTCACCTGAAGG - Intergenic
1198225985 X:134646423-134646445 TGTCTTTTCAATGCACCAAAAGG - Intronic
1198894825 X:141441971-141441993 TATCACTTCTGTTCACCTTAGGG - Intergenic
1201432638 Y:13920896-13920918 CGTCATTTCAGTTAAGATAATGG + Intergenic
1202247262 Y:22832951-22832973 TGTCATTTCAGTTCCTCAACCGG - Intergenic
1202400251 Y:24466699-24466721 TGTCATTTCAGTTCCTCAACCGG - Intergenic
1202470530 Y:25203387-25203409 TGTCATTTCAGTTCCTCAACCGG + Intergenic