ID: 990266992

View in Genome Browser
Species Human (GRCh38)
Location 5:54087376-54087398
Sequence GGAGCTGCAGCCCAAGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 18, 3: 41, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990266992 Original CRISPR GGAGCTGCAGCCCAAGATCT CGG (reversed) Intronic
900144344 1:1151388-1151410 GGGCCTGGAGCCCGAGATCTGGG - Intergenic
901465265 1:9417291-9417313 GTAGCCGCTGCCCAACATCTAGG + Intergenic
901631311 1:10649501-10649523 GGAGCAACAGCCGAAGCTCTGGG + Intronic
901789533 1:11647107-11647129 GGAGATGCAGCCCCTGCTCTGGG - Intergenic
901974400 1:12932736-12932758 GGAGGGGCAGCCCCTGATCTTGG + Intronic
902010772 1:13269031-13269053 GGAGGGGCAGCCCCTGATCTTGG - Intergenic
905238440 1:36566257-36566279 GGAGCTGCAGCCCCAGAGAAAGG - Intergenic
905716626 1:40157278-40157300 GGAGCTTCAGCTGAAGATGTGGG - Intergenic
906183452 1:43841082-43841104 GGCGGAGCTGCCCAAGATCTTGG - Intronic
906511268 1:46411630-46411652 GGAACTGCAGCACGAGATCGAGG + Exonic
906540634 1:46583188-46583210 GAAGCTGCAGGCCCAGATATAGG + Intronic
906766675 1:48440409-48440431 TTAGCTGCAGCCCAAGAGTTTGG + Intronic
906808289 1:48801295-48801317 GGAGCTGCAGCCAACGGTGTGGG - Intronic
907044086 1:51289102-51289124 GGAGCTGGAGCCCAAGGTACAGG - Intronic
908300412 1:62756683-62756705 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
912239828 1:107894554-107894576 GGAGCTGCCTGCCAAGATTTAGG - Intronic
912401045 1:109393075-109393097 GGAGCTGCCGCTGAAGACCTCGG - Intronic
912978443 1:114350174-114350196 GGAGCTCCAGCTCCAGAGCTGGG + Intergenic
913147250 1:116004163-116004185 GGTGCTGCAGCCAAAGAGATGGG - Intronic
914344960 1:146790920-146790942 TGAGTTGCAGGCTAAGATCTGGG - Intergenic
915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG + Exonic
915736324 1:158087842-158087864 TCACCTGTAGCCCAAGATCTCGG - Exonic
917108002 1:171514561-171514583 GGAGCTGCAACCCCAGGTTTTGG - Exonic
917733681 1:177901148-177901170 GGGGCTGAAGTCCAAGAGCTAGG - Intergenic
919165759 1:193889372-193889394 GGTGCTGCAGCCCAGGAGATGGG - Intergenic
919729438 1:200903410-200903432 GGAGGTGGAGCCCAGGATCAAGG + Intronic
920147369 1:203873459-203873481 GGAGCTGCAGTCCTAGATCTTGG - Intergenic
920732109 1:208497035-208497057 AGGGCAGCAGGCCAAGATCTTGG + Intergenic
921360653 1:214328734-214328756 GGAGCTGAAGCCCAAGATGCAGG + Intronic
922929936 1:229381217-229381239 GCTGCTGCAGCCCCAGGTCTTGG - Intergenic
1063714598 10:8514417-8514439 GGATCTGCAGTCCCAGATTTCGG - Intergenic
1063859087 10:10289301-10289323 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1064603570 10:17016424-17016446 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
1065603427 10:27392609-27392631 GGAGCTACAGTTCAAGATTTGGG - Intergenic
1067008386 10:42687484-42687506 GGTGCTGCAGCCCAGGAGATGGG + Intergenic
1068215436 10:53977125-53977147 GGTGCTGCAGCCCAGGAGATGGG - Intronic
1068500311 10:57835100-57835122 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1069736166 10:70655909-70655931 GGACCTGCAGGCCAAGCTATGGG - Intergenic
1069758803 10:70793263-70793285 GGAGTCTTAGCCCAAGATCTAGG - Intergenic
1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG + Intergenic
1071770911 10:88728192-88728214 TGAGCTGCAGTCCCAGATCTCGG + Intronic
1073261237 10:102192137-102192159 GGTGCTGCAGCCCAGGATATGGG - Intergenic
1073543852 10:104333251-104333273 GGTGCTGCAGTCTCAGATCTGGG - Intronic
1073765426 10:106677084-106677106 GGTGCTGCAGCCAAGGATATGGG - Intronic
1073776397 10:106790361-106790383 GGTGCTGCAGCCAATGAGCTGGG + Intronic
1074765885 10:116699681-116699703 GGAGCTGCTGCCCTAAAGCTGGG - Intronic
1075014377 10:118899483-118899505 TGAACTGCACCCCAAAATCTTGG + Intergenic
1075307899 10:121384147-121384169 GGTGCTGCAGCCAAAGAGATGGG + Intergenic
1075457223 10:122592604-122592626 GGAGAGGGAGCCCAAGGTCTTGG - Intronic
1075844051 10:125530714-125530736 GGAAGTCCAGCCCTAGATCTAGG + Intergenic
1076052306 10:127345679-127345701 GCAGCTGCAGCCCACCACCTTGG + Intronic
1076613601 10:131742498-131742520 GGTGCTGGGGCCCAGGATCTGGG - Intergenic
1077183415 11:1226338-1226360 GCAGCTGCACCCCTAGATCTGGG - Intronic
1077529575 11:3088875-3088897 GAGGCTGGAGTCCAAGATCTCGG - Intronic
1077730385 11:4723464-4723486 AGAGCTGCAGTCCCAGATTTCGG - Intronic
1077909625 11:6562942-6562964 GGCCCTGCAGCTCCAGATCTTGG - Intronic
1077951448 11:6962251-6962273 AGAGCTGCAACCTGAGATCTAGG + Intronic
1078191480 11:9095181-9095203 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1079068391 11:17319444-17319466 AGCCCTGCAGACCAAGATCTGGG + Intronic
1079641438 11:22810115-22810137 GGTGCTGCAGCCAAGGAGCTAGG + Intronic
1080123730 11:28706486-28706508 GGAGCTCCAGCCCACAATCAGGG - Intergenic
1081146000 11:39563089-39563111 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1081708350 11:45199916-45199938 TGAGCTGCAGCCCTGGACCTGGG - Intronic
1082906126 11:58310273-58310295 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1083913900 11:65727659-65727681 GAAGCTGCAGTCCCAGATCTCGG + Intergenic
1084659745 11:70539836-70539858 GGAGGTGAAGTCCAAGATCAAGG + Intronic
1084771023 11:71343121-71343143 GGGGTTGCAGCCCAAGATCAAGG - Intergenic
1085016968 11:73180197-73180219 GGAGCTGCACACCAAGGTGTTGG - Intergenic
1085699401 11:78732711-78732733 GGAGCTGCAGTCAAATATTTAGG - Intronic
1087074326 11:94115156-94115178 GAATCTGCAGCCCAAGGTCAGGG - Intergenic
1087442994 11:98208704-98208726 GCAGCTGCAGCTCCAGACCTGGG - Intergenic
1087458989 11:98422585-98422607 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1087497323 11:98907962-98907984 GAAGCTCCAGCCCAAGCTCTAGG - Intergenic
1088492548 11:110401793-110401815 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1088619960 11:111671666-111671688 GGAGCTGCTGTCCCAGATCTTGG - Intronic
1089213427 11:116821286-116821308 GGAGCTCAAGGCCAGGATCTCGG - Exonic
1090640828 11:128727576-128727598 CTTGCTGCAGCCCAAGACCTTGG + Intronic
1090651400 11:128809915-128809937 AGAGCTGCAAGCCAAGCTCTGGG + Intronic
1092195949 12:6549866-6549888 GGAGCTGGACACCAAGATCCAGG - Exonic
1092260539 12:6951359-6951381 GGAGTGGCAGCCCCAGAACTGGG + Exonic
1092348645 12:7737549-7737571 GGAGCTGCTGCCCAACCCCTTGG - Exonic
1092472311 12:8790680-8790702 TTAGCTGCAGCCCGAGAGCTTGG + Intergenic
1093682960 12:22023927-22023949 GGAGGTGCTGCCCAAGACCACGG + Intergenic
1094338097 12:29383347-29383369 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1094473188 12:30822480-30822502 GGAGCTCCAGCCCAGCAGCTGGG - Intergenic
1094802942 12:34058717-34058739 GGAGGTGAAGTCCAAGATCAAGG - Intergenic
1095116346 12:38357216-38357238 GGAGGTGAAGTCCAAGATCAAGG - Intergenic
1096626663 12:52900035-52900057 GGAGCTGCAGTCCCAGATCTCGG - Exonic
1097147957 12:56954592-56954614 GGATCTGAAGCCAAAGATCCAGG + Intronic
1097169630 12:57105517-57105539 GGAGCTTGAGCCCAAGACCCGGG - Exonic
1097615516 12:61880021-61880043 GGAGCTGCAGTCCCTGATCTCGG + Intronic
1098264655 12:68706333-68706355 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1098392215 12:69981406-69981428 GGAGCTCAAGACAAAGATCTTGG + Intergenic
1098689762 12:73472310-73472332 GAAGCTGAAGGGCAAGATCTTGG + Intergenic
1099576852 12:84393200-84393222 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1100330119 12:93573448-93573470 GCGGCTGCAGCCCAGGATCTTGG + Intronic
1101102459 12:101407685-101407707 GGAGCTGCAGCCGAAGGCCAAGG - Exonic
1101863621 12:108503097-108503119 GGTGCTGCAGCCCAAGAGATAGG + Intergenic
1101923883 12:108955411-108955433 GGAGCCGCAGCCATAAATCTGGG - Intronic
1102768110 12:115450968-115450990 GGTGCTGCAGCCCTGGAGCTGGG - Intergenic
1104306191 12:127612666-127612688 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1104390451 12:128387316-128387338 GGTGCAGAAGCCCCAGATCTGGG - Intronic
1104860541 12:131921183-131921205 GGGGCTGCAGCACATGCTCTCGG + Exonic
1105610929 13:21969419-21969441 GGAGCTGTGGCTCCAGATCTTGG + Intergenic
1106196358 13:27497593-27497615 GGAGCTGCAGCCCAGGCTGCAGG + Intergenic
1107917746 13:45169419-45169441 GGGGCTGAAGTCCAAGATCGAGG - Intronic
1108848610 13:54702651-54702673 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1109658554 13:65427939-65427961 TGAGGTGAAGCCCAAGGTCTGGG + Intergenic
1110377846 13:74814445-74814467 GAAGCTGCAGCCCAATCTCTAGG - Intergenic
1112519131 13:100080685-100080707 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1112538381 13:100283202-100283224 TTAGCTGCAGCCCAAGAGTTTGG + Intronic
1112566238 13:100553162-100553184 GGAGGTGCATGGCAAGATCTGGG + Intronic
1113819606 13:113203856-113203878 GGACTTGCAGACCAAGACCTGGG - Intronic
1114417662 14:22555114-22555136 GCAGCTGCAGCCCAAGGCCTTGG - Intergenic
1115285450 14:31709529-31709551 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
1115951573 14:38727735-38727757 GGAGCTGCAGTCCCAGGTCTGGG + Intergenic
1117966212 14:61209389-61209411 GAAGCTGGAATCCAAGATCTTGG - Intronic
1119294046 14:73518912-73518934 GGTGCTTCAGCCCATGAACTGGG + Intronic
1120817985 14:88883297-88883319 GAAGCTGCTGCCCAAGGCCTTGG - Intergenic
1121437670 14:93929721-93929743 GGCGCTGGGGGCCAAGATCTTGG + Intergenic
1121526672 14:94624149-94624171 TCAGCTCCACCCCAAGATCTGGG + Intronic
1122969154 14:105145432-105145454 GGAGCTACAGCCCAAGAGCTGGG + Intronic
1123991938 15:25689796-25689818 GGAGCACCAGCCCAAGCCCTGGG - Intronic
1124237273 15:28001754-28001776 GGAGCTGCAGCCCCAGAATGTGG + Intronic
1124442585 15:29697989-29698011 GGAGCTGTTGCCCAAGATGCAGG - Intergenic
1125841079 15:42801693-42801715 GGAGCTGCAGTCCCAGATCTCGG - Intronic
1125967659 15:43887259-43887281 TGAGGAGCAGCCCAAGAACTGGG - Intronic
1126467266 15:48972594-48972616 AGAGCTGCAGTCCCAGATCTTGG + Intergenic
1127813266 15:62582718-62582740 GTATCTGCAGCCCAGGAACTTGG + Intronic
1128229687 15:66025800-66025822 GGACCTGCTTCCCAAGCTCTGGG + Intronic
1128842190 15:70859411-70859433 GGAGCTGCAGTCCCACATCTCGG + Intronic
1130351221 15:83093449-83093471 GGAGCTGCAGCCCAGGAGTGAGG - Intergenic
1131119701 15:89814675-89814697 GGAGCTGCAGACCCAGCGCTTGG - Intronic
1131266534 15:90918715-90918737 GCAGTTGAAGCCCAAGTTCTTGG - Exonic
1131529574 15:93180075-93180097 GAAGCAGCAGCCCCAGCTCTCGG - Intergenic
1133021123 16:2967401-2967423 TGAGCTGCAGCCCCAGGCCTGGG + Exonic
1133542034 16:6765244-6765266 GCTCCTGCAGGCCAAGATCTGGG + Intronic
1136497779 16:30654630-30654652 GGAGCTCCAGAGCAGGATCTGGG - Exonic
1136658610 16:31732186-31732208 CCAGCTGGAGCCCAAGATCAAGG - Intronic
1138297098 16:55896319-55896341 GGAGCTACAGTTCAAGATTTGGG + Intronic
1138329096 16:56198934-56198956 GCTGCTTCAGCCCAAGAGCTGGG + Intronic
1138351211 16:56347262-56347284 GGAGCTGGAGCCTCAGGTCTGGG - Exonic
1139955920 16:70692954-70692976 GCAGCTGCAGGCGCAGATCTGGG + Exonic
1139989032 16:70924384-70924406 TGAGTTGCAGGCTAAGATCTGGG + Intronic
1140753777 16:78049178-78049200 GGAGCTGCAGTCCCAGATATCGG - Intronic
1141151092 16:81565199-81565221 TGAACTTCAGCCCAAGATCTGGG + Intronic
1203141890 16_KI270728v1_random:1772142-1772164 GGAGATGCATCCCCAGATATGGG - Intergenic
1144235503 17:13256872-13256894 GGAACTGAAGCCCATTATCTAGG + Intergenic
1144664034 17:17090135-17090157 GGTGTTGCAGACCAAGACCTTGG + Intronic
1147350124 17:39835684-39835706 GGAGCTCCAGTCCCAGATCTTGG - Intronic
1147660552 17:42114758-42114780 GGAGGGGCAGGCCAGGATCTTGG - Intronic
1147833976 17:43316979-43317001 GCAGCTGCAGCCTTAGGTCTTGG - Intergenic
1148219340 17:45850864-45850886 GGGGCAGCAGGGCAAGATCTAGG - Intergenic
1150205660 17:63404620-63404642 GGAATTGCAGTCCAAGGTCTTGG - Intronic
1150529254 17:65959540-65959562 AGAGCTACAGCCCCAGACCTGGG + Intronic
1151124010 17:71825624-71825646 GGGGTAGCAGCCCAAGCTCTGGG + Intergenic
1151233934 17:72704755-72704777 GGAGCTCCAGTCCAAGCTCTAGG + Intronic
1151568017 17:74910754-74910776 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1151743662 17:76000625-76000647 GGAGCTGCAACCCAGGCTGTGGG + Intronic
1152010190 17:77708238-77708260 GAGGCTGAAGTCCAAGATCTAGG + Intergenic
1152783070 17:82234975-82234997 GGAGCTGCAACCTGAGACCTTGG - Exonic
1152864799 17:82716350-82716372 GGGGCATCAGCCCAAGGTCTGGG - Intergenic
1153031025 18:712762-712784 GGAGCTGCAGTCCCAGCTCCGGG + Intergenic
1153810393 18:8747257-8747279 GGGACTGCAGTCCAAGATCAGGG + Intronic
1153810417 18:8747361-8747383 GGGGCTGCAGTCCAAGATCAAGG + Intronic
1156120735 18:33840061-33840083 GCATCTGTAGCCCAAGAGCTGGG - Intergenic
1156917239 18:42476243-42476265 GGAGTTCCAGCACATGATCTCGG - Intergenic
1158346830 18:56524437-56524459 TCAGCAGCTGCCCAAGATCTTGG + Intergenic
1158906416 18:62017656-62017678 GGAGCTGAAGGCCATGGTCTCGG - Intergenic
1159814240 18:73053377-73053399 GGTGCTGCAGCCAAGGATATGGG - Intergenic
1159948706 18:74463066-74463088 GGAGCTGCAGCCCAAGAACGTGG + Intergenic
1160707248 19:535420-535442 GGAGCTGAAGCCCAGGACCAGGG - Intronic
1161154761 19:2726882-2726904 TGAGCTGCAGCCCTGGCTCTGGG - Intronic
1161195191 19:2982726-2982748 GGAGATGCTCCCCAAGATATGGG - Intronic
1161416545 19:4150268-4150290 GGAGGTGAATCCCAGGATCTGGG + Intergenic
1161598232 19:5163526-5163548 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
1162107916 19:8381869-8381891 TTAGCTGCAGCCCAAGACTTTGG + Intronic
1162121164 19:8469806-8469828 GGAGCAGCAGCTCAAGCTCAGGG + Intronic
1164588349 19:29491746-29491768 GGAGCAGCAGCTCAGGAACTGGG + Intergenic
1164992947 19:32697691-32697713 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
1165810318 19:38607983-38608005 GGAGCAGCAGCCCCAGGTCAGGG - Exonic
1165854411 19:38871019-38871041 GGAGCTGCTGCCCCTGTTCTAGG - Intronic
1167591998 19:50409188-50409210 GGGGCTGCTGCCCCAGATCCTGG + Exonic
1168309941 19:55455291-55455313 GGACCTGCAGCCCCCGGTCTAGG + Exonic
1168724882 19:58575630-58575652 GGAGCTGCAGCCCCTCCTCTTGG + Intergenic
926277249 2:11413721-11413743 GGAGATGGAGCCCAAGAAGTAGG + Intergenic
926766873 2:16329907-16329929 AAAGCCGCAGCCTAAGATCTGGG - Intergenic
926864414 2:17342245-17342267 ATAGCTGCAGCCCAAGAGTTTGG + Intergenic
927045711 2:19276118-19276140 GGAGCTGCAGCAGAGGAGCTAGG - Intergenic
927236747 2:20881779-20881801 GAAGCTGAAGTCCAAGATCAAGG - Intergenic
927679069 2:25128240-25128262 TGAACTGCAGGCCAATATCTGGG + Exonic
928617625 2:33055582-33055604 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
929397118 2:41535748-41535770 GGTGCTGCAGCCAAAGAGATGGG - Intergenic
929488030 2:42372112-42372134 GCAGCAGCAGACCAAGCTCTGGG + Intronic
929818706 2:45256907-45256929 GGAGCTGCAGCTCAGGAACCAGG + Intergenic
931540486 2:63324643-63324665 TTAGCTGCAGCCCAAGAGTTTGG + Intronic
934510221 2:94932645-94932667 GGTGCTGCAGCCCAGGAGCTGGG + Intergenic
934567968 2:95351034-95351056 GCAGCAGCAGCCCAGGAGCTTGG + Intronic
934867119 2:97823498-97823520 TTAGCTGCAGCCCAAGAATTTGG + Intronic
936039908 2:109142067-109142089 GGGGCTGCAGCAGAAGTTCTAGG - Intronic
936730268 2:115374363-115374385 GGAAGAGCAGCCCAAGATGTTGG - Intronic
937475350 2:122210016-122210038 TGAGCTGCAGGCAAAGGTCTGGG + Intergenic
938341020 2:130536673-130536695 GGAGCCTCAGCCGAAGATGTGGG + Intergenic
938348810 2:130584036-130584058 GGAGCCTCAGCCGAAGATGTGGG - Intronic
938380926 2:130836336-130836358 GGAGCTGGAGGCCAAGACTTCGG + Intergenic
938767296 2:134468825-134468847 GGAGCTGCAGACCCAGGGCTCGG + Intronic
938806194 2:134809005-134809027 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
939851853 2:147313783-147313805 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
941809623 2:169742652-169742674 GGAGATGCAGCACCAGATTTAGG - Intronic
943103077 2:183510544-183510566 TAAGCTGCAGCCCAAGAGTTTGG - Intergenic
944763495 2:202841060-202841082 GAAGCTGCAGTCCCAGATCTTGG - Intronic
946495659 2:220192972-220192994 AGAGCTGCAGCCCCAGACCTAGG + Intergenic
946598416 2:221332302-221332324 GGAGCTGCAATTCAAGATTTGGG + Intergenic
946885073 2:224215131-224215153 GAGGCTGAAGCCCAAGATCAAGG + Intergenic
947793920 2:232882643-232882665 TCAGCTGCAGCCCCAGGTCTGGG + Intronic
948432392 2:237928017-237928039 GGTGCTGCAGCCAAGGATTTGGG + Intergenic
948436723 2:237958778-237958800 GAAGCTGGAGTCCAAGATCCAGG + Intergenic
948881868 2:240862668-240862690 GGAGTTTTAGCCCAAGATCTGGG + Intergenic
1169260751 20:4136313-4136335 GGAACAGTAGCCCAAGACCTTGG + Intronic
1171213738 20:23336682-23336704 GGAGCAGCAGCTCAAGGTCCAGG - Intergenic
1171401380 20:24874890-24874912 GGAGCTGCATCCCAAAATACAGG + Intergenic
1172975247 20:38901230-38901252 GCAGCTGCAGCTGAGGATCTGGG - Intronic
1173064032 20:39692245-39692267 GCAGCTGCAGCCCAAGAGGAAGG - Intergenic
1174580962 20:51571269-51571291 GCAGCTGCATCCCAAGTGCTTGG - Intergenic
1175368564 20:58471516-58471538 GGCGCTGCAGCACAAGCTCCAGG + Intronic
1176150742 20:63589493-63589515 GGATCTGCACCCCAAGCTCCGGG + Exonic
1177135063 21:17299187-17299209 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1177401789 21:20614339-20614361 GAAGGAGCTGCCCAAGATCTTGG + Intergenic
1179236509 21:39552022-39552044 GGTGCTGCAGCCCAGGAGATGGG + Intergenic
1180182997 21:46126331-46126353 GAATGTGCAGCCCAGGATCTTGG + Intronic
1180788936 22:18563267-18563289 GGAGCTACAGCCAAAGATCAAGG + Intergenic
1181232800 22:21432053-21432075 GGAGCTACAGCCAAAGATCAAGG - Intronic
1181245851 22:21502804-21502826 GGAGCTACAGCCAAAGATCAAGG + Intergenic
1181455398 22:23057475-23057497 GGGGCTGGAGTCCCAGATCTGGG + Intergenic
1181550657 22:23637295-23637317 GGAGCTGGAGCCCCAGACCCTGG + Intergenic
1181797625 22:25321385-25321407 GGAGCTGGAGCCCCAGACCTAGG - Intergenic
1183311786 22:37113746-37113768 GGGGCTGGAGTCCAAGATCCAGG - Intergenic
1184635971 22:45831865-45831887 GGAGCTCCAGCACAGGCTCTGGG - Intronic
1184846947 22:47093934-47093956 GGTGCTGCAGCCCAGGAGGTGGG + Intronic
1184970301 22:48015226-48015248 GGATCTGCACCCCAAGAACCCGG + Intergenic
1184981181 22:48096989-48097011 GGAGCTGCAGAACAGGCTCTGGG + Intergenic
950204110 3:11064818-11064840 GGTGCTGCAGCCCAGGAGATGGG - Intergenic
950462295 3:13132542-13132564 GGAGCTGCTGCTCAAAGTCTGGG - Intergenic
951163669 3:19458752-19458774 GGACCTGCAGCCCCAGCTCATGG + Intronic
952611595 3:35216433-35216455 GCAGTTGCAGTCCCAGATCTCGG - Intergenic
952735053 3:36681044-36681066 GAAGCAGCAGCCCAAGTACTTGG + Intergenic
954232277 3:49226674-49226696 TTAGCTGCAGCCCAAGAGTTTGG - Intronic
954284881 3:49611849-49611871 GGAGCTGCTGACCTAGGTCTTGG + Intronic
954586974 3:51744730-51744752 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
956842969 3:73157101-73157123 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
959052100 3:101534262-101534284 GGAGCCTTATCCCAAGATCTGGG - Intergenic
962654911 3:137533327-137533349 GGAAATGCAGGCCCAGATCTAGG - Intergenic
962712860 3:138102196-138102218 GGAGCTGCAGTCCCAGATCTCGG - Intronic
963696743 3:148573238-148573260 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
964064490 3:152562221-152562243 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
965605719 3:170496130-170496152 GGAGCTGCAGTCCCAGATCTCGG + Intronic
966019979 3:175196827-175196849 ACAGCTGCAGCCCTCGATCTAGG + Intronic
967583609 3:191187842-191187864 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
968184342 3:196621627-196621649 GGAGCTGCTTCCCTAGATCAGGG + Intergenic
968592660 4:1466593-1466615 GGAGCTGCAGCCTGAGACCTTGG + Intergenic
968764738 4:2462506-2462528 GCAGCTGCGGCGCAGGATCTCGG + Exonic
969252704 4:5980167-5980189 GGAGCTCCAGGCCAAGGTGTGGG - Exonic
970050159 4:11905274-11905296 GGGGCTGCAGCCCAAGTGCCGGG - Intergenic
971506420 4:27371150-27371172 CGAGACGCAGCCCATGATCTTGG - Intergenic
973102971 4:46295148-46295170 AGCACTGCAGCCCAAGTTCTAGG + Intronic
974487557 4:62524857-62524879 GAAGCCACAGCCCAAGCTCTAGG - Intergenic
975945064 4:79696083-79696105 GGAGCTGCAGCCCACAGTGTGGG - Intergenic
977928724 4:102729452-102729474 GGAGCTGCAGTCCCAGATCTCGG - Intronic
979299582 4:119071417-119071439 GGAGTTGGAGTCCAAGATCAAGG + Intergenic
982448325 4:155521575-155521597 GGTGCTGCAGCCCAGGAGATGGG + Intergenic
984344180 4:178500332-178500354 GGATTTGCACACCAAGATCTGGG - Intergenic
986259935 5:6135088-6135110 GCAGCTACAGCCAAGGATCTTGG - Intergenic
987694242 5:21307782-21307804 GGAGCTGCAGCCCCTGGTTTTGG - Intergenic
987929873 5:24389569-24389591 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
989496224 5:42113725-42113747 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
989730557 5:44642292-44642314 CCAGCTGCAGCTCTAGATCTGGG - Intergenic
989957330 5:50372750-50372772 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
990266992 5:54087376-54087398 GGAGCTGCAGCCCAAGATCTCGG - Intronic
990367889 5:55088766-55088788 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
990900543 5:60744282-60744304 GGAGCTGCAGTCCCAGATCTCGG - Intergenic
991746004 5:69741687-69741709 GGAGCTGCAGCCCCTGGTTTTGG + Intergenic
991751700 5:69813554-69813576 GGAGCTGCAGCCCCTGGTTTTGG - Intergenic
991797606 5:70321645-70321667 GGAGCTGCAGCCCCTGGTTTTGG + Intergenic
991825382 5:70617001-70617023 GGAGCTGCAGCCCCTGGTTTTGG + Intergenic
991830988 5:70688447-70688469 GGAGCTGCAGCCCCTGGTTTTGG - Intergenic
991889948 5:71320966-71320988 GGAGCTGCAGCCCCTGGTTTTGG + Intergenic
994320853 5:98392806-98392828 GGAGCTGCAGTCCCAGATCTTGG - Intergenic
997844788 5:137276614-137276636 GGAGCTGCAGTCCAAGATACTGG - Intronic
998263234 5:140647265-140647287 CGATGTGCAGCCCAAGCTCTGGG - Exonic
998887221 5:146706896-146706918 GGAGCTGCAGTCCCAGATCTCGG - Intronic
998915043 5:147003558-147003580 TTAGCTGCAGCCCAAGAGTTTGG + Intronic
999205844 5:149847334-149847356 GTGGCTGCAGCCCAAGGCCTTGG - Intronic
999410599 5:151346679-151346701 GGAGCTGCAGCCCTGTAGCTTGG + Intronic
1001209643 5:169798113-169798135 GGAGCTGCAGACCAGGCACTAGG - Intronic
1002166881 5:177353261-177353283 GAAGCAGCAGCAAAAGATCTAGG + Intergenic
1002989269 6:2222984-2223006 GCAGCTCCAGTCCAACATCTAGG - Intronic
1003220242 6:4154771-4154793 GGAGGGGCAGCCCAAGACCCTGG + Intergenic
1004080322 6:12386196-12386218 CGAGCTGCAGCCCCAGGCCTGGG + Intergenic
1004812215 6:19273629-19273651 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1005315449 6:24599051-24599073 GGAGCTGCAGTCCCAGATCTGGG + Intronic
1005556665 6:26992152-26992174 GGAGCTGCAGCCCCTGGTTTTGG + Intergenic
1006642588 6:35496756-35496778 GGAGCTGGAGCCCCGGATCGGGG - Intronic
1006819065 6:36876273-36876295 GGAGCTGCAGTAAAAGATTTAGG - Intronic
1007112652 6:39321909-39321931 GGAGCTGCAGCCCTGGAGTTGGG + Intronic
1007487307 6:42190055-42190077 GGAGCCCCAGCCCCAGATCAAGG + Intronic
1008504569 6:52217079-52217101 AGAGCTGAAGCCACAGATCTCGG - Intergenic
1009538483 6:64922861-64922883 GGAGATGGACCCCAAGCTCTAGG + Intronic
1011603629 6:89081485-89081507 GGGTCTGCAGCCCCAGAGCTCGG - Intronic
1012429962 6:99153861-99153883 GAAGCAGCAGCCCAAGAGATAGG + Intergenic
1012768337 6:103397449-103397471 GGAGGAGCTGCCCAAGACCTTGG + Intergenic
1012916748 6:105179477-105179499 GGACCTGCAGGAAAAGATCTGGG + Intronic
1014306775 6:119752766-119752788 GTGGCTGCAGCCCTATATCTAGG + Intergenic
1015539286 6:134298003-134298025 GGAGCTGCAGTCCCAGATCTCGG - Intronic
1017345847 6:153379808-153379830 GGAGGTGCAGCCAAAGGGCTTGG + Intergenic
1018317216 6:162569009-162569031 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1019781028 7:2939748-2939770 GGAGCTGCAGTCCATCATCCAGG - Exonic
1023289602 7:38655892-38655914 GGAGCTGCAGTCCTAGATCTCGG + Intergenic
1024421378 7:49170924-49170946 GGTGCTGCAGCCAAAGAGATGGG - Intergenic
1024931730 7:54671530-54671552 GGAGCTGCTGCTCATGGTCTTGG - Intergenic
1025027758 7:55531874-55531896 GGATCTGCTGGCCAAGATTTAGG - Intronic
1027808368 7:82859481-82859503 GGTGGTGTAGCACAAGATCTGGG - Intronic
1030143766 7:106332017-106332039 GGAGCTGAATGCCAAGAGCTGGG - Intergenic
1031544191 7:123032165-123032187 GGAGGTGCAGCCGCAGAGCTGGG + Intergenic
1032592391 7:133204335-133204357 AGTGCAGCAGCCCACGATCTTGG + Intergenic
1033342685 7:140504443-140504465 GGTGCTGCAGCCCAGGAGATGGG - Intergenic
1034210334 7:149357649-149357671 GGAGCTGTAGCCACAGACCTAGG - Intergenic
1035777828 8:2203237-2203259 GCAGCCGGAGCCAAAGATCTGGG - Intergenic
1036762299 8:11517782-11517804 GGTGCTGCAGGCCAAGCTCTTGG + Intronic
1037280609 8:17237765-17237787 GGAGCTGCAGCCATAGCTGTGGG + Intronic
1037627435 8:20620306-20620328 GGTGCTGCAGCCCATTATATGGG + Intergenic
1037921750 8:22811563-22811585 GGGGCTGCAGCCCCAAATGTGGG + Intronic
1038394779 8:27238669-27238691 GGACTTGGAGCCAAAGATCTGGG + Intronic
1038642642 8:29340122-29340144 GGAGCTGCAGCCCAGGTCCAAGG + Exonic
1039460138 8:37736873-37736895 GGAGCCGCAGCCCCAGACCAGGG + Intronic
1039999711 8:42565740-42565762 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1040999973 8:53440447-53440469 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1041001873 8:53461996-53462018 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1041380632 8:57250998-57251020 GGAACTGGAGTCCAAGGTCTAGG + Intergenic
1041781093 8:61578918-61578940 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1043673559 8:82920008-82920030 TGAGCTCCAGACCAAGTTCTTGG - Intergenic
1047620177 8:126598327-126598349 GGTGCTGCAGCCAAGGATATGGG + Intergenic
1047929463 8:129712559-129712581 GGAGCTGCAGCCCAATGATTCGG - Intergenic
1048686215 8:136907820-136907842 TGAGCTGCAGCCAAAGATCACGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049874432 8:145007213-145007235 GAGGCTGAAGCCCAAGATCAGGG + Intergenic
1050851771 9:10296550-10296572 GGTGCTGCAGCCAAGGATATGGG - Intronic
1053655172 9:40211652-40211674 GGTGCTGCGGCCCAGGAGCTGGG - Intergenic
1053905556 9:42840888-42840910 GGTGCTGCAGCCCAGGAGCTGGG - Intergenic
1054367288 9:64357868-64357890 GGTGCTGCGGCCCAGGAGCTGGG - Intergenic
1054674918 9:67847605-67847627 GGTGCTGCGGCCCAGGAGCTGGG - Intergenic
1055428430 9:76219109-76219131 GGAGCTGCATACCAAGGCCTGGG - Intronic
1056692991 9:88823851-88823873 GAAGCTGGATCCCCAGATCTGGG + Intergenic
1057372124 9:94483461-94483483 GGTGCTGCAGCCCAGGAGCTGGG - Intergenic
1057804212 9:98209068-98209090 GAAGCTGCTGGCCAAGATCCAGG - Exonic
1058868008 9:109179445-109179467 GAAGCTGAAGCCCATGAGCTTGG + Intronic
1059443847 9:114326012-114326034 GGAGCTGCAGCATAAGGGCTCGG + Intronic
1060059680 9:120448012-120448034 GCAGCTGCAGAGCCAGATCTTGG - Exonic
1060263107 9:122092959-122092981 GGAGGAGCAGCCCAAGGTCCTGG - Exonic
1060282382 9:122223076-122223098 TGCACTGCAGCCCAAGCTCTGGG - Intronic
1060792773 9:126497277-126497299 GGAGCTGCAACCCAGGAGCAGGG - Intronic
1061167719 9:128933862-128933884 GGAGCTGGGGCCCTAGAGCTGGG + Intronic
1061793516 9:133071067-133071089 GGAGCTGCTGCCCATCTTCTTGG - Exonic
1061796125 9:133086866-133086888 GGAGCTGCTGCCCATCTTCTTGG - Intronic
1062253276 9:135608824-135608846 GCTGCTGCAGCCCAGGACCTGGG + Intergenic
1062333361 9:136054235-136054257 GGAGCTGGAGCCCCAGGGCTGGG + Intronic
1185550554 X:980354-980376 GGAGATGCATCCCCAGATATGGG + Intergenic
1186594986 X:10971173-10971195 AGAGCAGCACCCCAGGATCTTGG + Intergenic
1187265145 X:17725599-17725621 TGAGCAGCCGCACAAGATCTCGG + Exonic
1189433810 X:40973311-40973333 GGAGCTGCAGCTCCAGAGCTTGG + Intergenic
1189893880 X:45633379-45633401 GGAGCAGCAGACCAAGATGCTGG - Intergenic
1190498063 X:51046259-51046281 GGAGATGCTGCTGAAGATCTTGG + Intergenic
1190508348 X:51151636-51151658 GGAGATGCTGCTGAAGATCTTGG - Intergenic
1190748530 X:53341341-53341363 GGAGCTGCAGGACAAGTTCTGGG + Intergenic
1191016252 X:55813376-55813398 CCAGCTGCAGCTCGAGATCTGGG + Intergenic
1191095255 X:56666540-56666562 GGAGGAGCAGGCCACGATCTTGG - Intergenic
1191220714 X:57985381-57985403 GGAGCTGCAGTCCCAGATCCTGG + Intergenic
1192482800 X:71499780-71499802 TTAGCTGCAGCCCGAGAGCTTGG - Intronic
1194008487 X:88528916-88528938 GGTGCTGCAGCCAAAGAGCTGGG + Intergenic
1194386673 X:93263958-93263980 GGAGGTGCAGCCACAGAACTGGG - Intergenic
1195003261 X:100662659-100662681 GGAGCTCCAGAAGAAGATCTAGG - Intronic
1195854320 X:109313896-109313918 GGCTCTGAAGCCCAAGATCAAGG + Intergenic
1196127391 X:112114383-112114405 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1196419424 X:115507212-115507234 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1196990351 X:121321886-121321908 ACAGCAGGAGCCCAAGATCTTGG - Intergenic
1199927211 X:152480272-152480294 GGAGCTGCATTCCCAGATCTCGG + Intergenic
1200690876 Y:6305825-6305847 GGAGCCACAGCCCAAGGCCTTGG - Intergenic
1200695009 Y:6351024-6351046 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic
1201040268 Y:9823686-9823708 TTAGCTGCAGCCCAAGAGTTTGG + Intergenic
1201044396 Y:9868891-9868913 GGAGCCACAGCCCAAGGCCTTGG + Intergenic
1201407545 Y:13663939-13663961 TTAGCTGCAGCCCAAGAGTTTGG - Intergenic