ID: 990271497

View in Genome Browser
Species Human (GRCh38)
Location 5:54146431-54146453
Sequence GGGCGCACTTAACTTTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990271497_990271498 -6 Left 990271497 5:54146431-54146453 CCTTGGAAAAGTTAAGTGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 105
990271497_990271506 20 Left 990271497 5:54146431-54146453 CCTTGGAAAAGTTAAGTGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 990271506 5:54146474-54146496 GTTTTGTTAGAGGAAAATACTGG 0: 1
1: 0
2: 1
3: 27
4: 270
990271497_990271504 10 Left 990271497 5:54146431-54146453 CCTTGGAAAAGTTAAGTGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 990271504 5:54146464-54146486 CCCATGGCTTGTTTTGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990271497 Original CRISPR GGGCGCACTTAACTTTTCCA AGG (reversed) Intronic
912046421 1:105464746-105464768 GGGAGTACTTATTTTTTCCAAGG - Intergenic
922809461 1:228407569-228407591 CAGCGCCCTTACCTTTTCCAAGG - Intergenic
1065836333 10:29661542-29661564 GGGCTCTCTTGACCTTTCCAAGG + Intronic
1066038319 10:31517913-31517935 GGGCTTAATTAACTTGTCCAAGG + Intronic
1067959990 10:50837455-50837477 GGGCTCACTTTTATTTTCCAGGG - Intronic
1070827660 10:79400660-79400682 GGGCGCACTGTGCTTTCCCAAGG + Intronic
1081125532 11:39316352-39316374 GTGGTCAATTAACTTTTCCAAGG - Intergenic
1091408371 12:223026-223048 GCTCGCACTTAACTTTTCCTGGG - Intronic
1091588054 12:1827288-1827310 GGGGGCACTTACCCTTTCTAGGG - Intronic
1094441623 12:30484090-30484112 AGGCGCACTTGAGTCTTCCAAGG - Intergenic
1106956769 13:34947701-34947723 AAACGCACTTAACTTATCCAAGG - Intronic
1109568323 13:64149759-64149781 GAGCTCAGTTAACTTTCCCAAGG + Intergenic
1109644984 13:65242013-65242035 GTGAGCACATAACTTTTCCTTGG - Intergenic
1113339753 13:109410490-109410512 AGGAGCAATAAACTTTTCCATGG + Intergenic
1121252226 14:92507746-92507768 GTGGGCACTTAAGTTTTCCTAGG + Intergenic
1130107887 15:80942747-80942769 GGGTGGACATAACTTTTGCAGGG + Intronic
1135110719 16:19688781-19688803 GAGCTCACATACCTTTTCCATGG - Intronic
1135607909 16:23838665-23838687 GGGATCACTTTACTTTTCCCTGG - Intronic
1138306304 16:55978980-55979002 TGGCAAACTTGACTTTTCCAAGG + Intergenic
1143196217 17:5078277-5078299 GGGTGCACTTTGCTGTTCCAGGG + Exonic
1143373851 17:6455909-6455931 GGGAGCTCTTTACTGTTCCAGGG + Intronic
1156694005 18:39744638-39744660 GGATACACTTAAATTTTCCAAGG - Intergenic
1158820101 18:61149607-61149629 TGGAGCAGTTAATTTTTCCAGGG - Intergenic
1162552104 19:11363810-11363832 CGCCACACTTAACTTTTCGAGGG - Exonic
1166605914 19:44142246-44142268 GGGAGCATTTAACTTTTCTCAGG + Intronic
1167023566 19:46897305-46897327 GGGTGCACTTATTTTCTCCAAGG + Intergenic
925593676 2:5534574-5534596 GGTCCCACTTAGCTTTTCTAGGG + Intergenic
927895773 2:26780793-26780815 GGCCACACTCAACTGTTCCAAGG - Exonic
929458114 2:42080644-42080666 GGGCTCAGTGAACTTTACCAGGG - Intergenic
934523459 2:95034170-95034192 GGGCACACTTGACTTTTCCCTGG + Intronic
934927042 2:98389258-98389280 GGGCCCACTCACCTCTTCCAGGG - Intronic
936965819 2:118126670-118126692 CTGCTCACTTAACTTCTCCAAGG + Intergenic
1169287954 20:4325331-4325353 GAGCCCACTAAACTTTTCCCTGG + Intergenic
1171428462 20:25063637-25063659 GGGCGCACTGCACTTCTGCAGGG - Intergenic
1173001123 20:39106442-39106464 GAGGGCTCTTAACATTTCCAGGG + Intergenic
1183450783 22:37893785-37893807 GGGCTCTCTTAACTGCTCCAAGG + Intergenic
1185065708 22:48630841-48630863 GGGCTCACTTTGCTTTTCCTCGG - Intronic
963044583 3:141093395-141093417 GGGGTCACATAACTTTCCCAAGG + Intronic
964819406 3:160754789-160754811 GGGCGCTCCTGACTTTTCTACGG - Intergenic
965723069 3:171683285-171683307 GGGCTGACTTACATTTTCCAAGG - Intronic
969884796 4:10205872-10205894 GAGAGCACTGAACTCTTCCAGGG + Intergenic
974909514 4:68099952-68099974 GGGAGCACTAAACTTTTTGAAGG + Intronic
983238550 4:165207052-165207074 GTGCTCACTTCACTTGTCCAAGG + Intronic
988194211 5:27980522-27980544 GGGCGCACAGAATTTTTCAAAGG + Intergenic
988938008 5:36108931-36108953 GGGTTCTCTTAACTTTTACATGG - Intronic
990271497 5:54146431-54146453 GGGCGCACTTAACTTTTCCAAGG - Intronic
994694620 5:103058568-103058590 GGCTGCACTTACCTTTTACATGG - Intergenic
995403090 5:111763482-111763504 GGACAAACTTGACTTTTCCAGGG - Intronic
999562968 5:152825275-152825297 GGGCACAGATAACTTTTCCTTGG + Intergenic
1023494193 7:40777315-40777337 GGGCACTCTTACCTTTTCCATGG + Intronic
1030992054 7:116312781-116312803 TAGCACCCTTAACTTTTCCACGG - Intronic
1035048495 7:155984461-155984483 GGGCCCACTTGGCTTTGCCATGG - Intergenic
1038112214 8:24512194-24512216 GGGAGCACTTCAGGTTTCCATGG - Intronic
1046525346 8:115375878-115375900 TGGCACACTTAACTTTTAAAAGG + Intergenic
1053196953 9:36126934-36126956 GTGCACACGTAACTTTTACAAGG - Intergenic
1062495919 9:136831643-136831665 GGGCGCACAGCACCTTTCCAGGG + Intronic
1194912840 X:99668175-99668197 GGGAGCATTTATTTTTTCCAGGG - Intergenic