ID: 990271498

View in Genome Browser
Species Human (GRCh38)
Location 5:54146448-54146470
Sequence GCGCCCTGCCCAATATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990271497_990271498 -6 Left 990271497 5:54146431-54146453 CCTTGGAAAAGTTAAGTGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990271498 Original CRISPR GCGCCCTGCCCAATATCCCA TGG Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
922912767 1:229231498-229231520 ACGTCCTGGCCAAGATCCCAGGG - Intergenic
1065239929 10:23694986-23695008 GCGCCCTGCGCAGCATCCCCGGG + Intronic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1071451076 10:85791881-85791903 GCCCCCTGCACAAAAGCCCAGGG - Intronic
1072695790 10:97601875-97601897 GCGCCCTGGCCAATGTCCTGGGG + Exonic
1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG + Intergenic
1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG + Intronic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG + Intergenic
1081935869 11:46903666-46903688 CCTCCCTGGCCAACATCCCAGGG - Intronic
1085730173 11:78991187-78991209 CTGTCCTGCCCAAAATCCCAGGG + Intronic
1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG + Intronic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1113679640 13:112234413-112234435 CAGCCCAGCCCCATATCCCAGGG + Intergenic
1116425601 14:44786612-44786634 GTGGCCTGCTCTATATCCCATGG - Intergenic
1122978133 14:105179370-105179392 GCGTCCAGCCCAATGTCCCTTGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126497812 15:49311945-49311967 GCCCCCGGCCCAATCTCTCAGGG - Intronic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128707948 15:69851193-69851215 GCTCCCTCCCCAGTATCCAATGG - Intergenic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1131431926 15:92394571-92394593 GCCCCCTGCCCACTTTGCCAAGG - Intronic
1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG + Intronic
1134524416 16:14932998-14933020 CCACCCTGCCCAACCTCCCACGG - Intronic
1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG + Intronic
1134712004 16:16331485-16331507 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134719861 16:16374778-16374800 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134763926 16:16739172-16739194 GCAACCTGCCCAAGATCCCCAGG - Intergenic
1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG + Intergenic
1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG + Intergenic
1134982128 16:18619991-18620013 GCAACCTGCCCAAGATCCCCAGG + Intergenic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG + Intergenic
1142251132 16:88992572-88992594 GCCCCCTGCCCAGTATCTCTCGG - Intergenic
1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG + Intronic
1146175574 17:30664042-30664064 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1146349021 17:32080088-32080110 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1152569403 17:81115137-81115159 GCGCCCTCCCCCATATCCCCGGG - Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1158322886 18:56282661-56282683 GTGCCCTGCCCATATTCCCAGGG + Intergenic
1158759662 18:60369468-60369490 GCACCCTCCCCTATATGCCATGG - Intergenic
1160178144 18:76612651-76612673 GAGCCCTGCCCAAAAGCTCATGG + Intergenic
1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG + Intergenic
1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG + Intronic
1165621453 19:37251952-37251974 GCGCTCAGCCGAACATCCCAAGG - Intergenic
1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG + Exonic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1167274391 19:48527821-48527843 TGGCCAAGCCCAATATCCCATGG + Intergenic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG + Intergenic
938694881 2:133826187-133826209 GGGCCCTGCACACTATGCCAGGG - Intergenic
946381103 2:219349608-219349630 GTGCCCTGCCTCATATCCAATGG - Intergenic
948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG + Intergenic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1174327868 20:49793776-49793798 TCTCCTTGCCCACTATCCCATGG + Intergenic
1177807631 21:25889595-25889617 CCGCCCTCCCCAACCTCCCAAGG - Intronic
1179524222 21:41965359-41965381 GCCCCCTGCCCACTATCCAGTGG - Intergenic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
951671037 3:25182347-25182369 GCACCATGCCCAGTACCCCATGG - Intronic
952844981 3:37680649-37680671 TCTCCCTGCCAAATATTCCATGG + Intronic
956303011 3:67792863-67792885 GAGCCCTTCCAAATAGCCCATGG + Intergenic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
959007632 3:101038385-101038407 GAACCCTGACTAATATCCCAGGG + Intergenic
965820579 3:172680578-172680600 GAGCCCTGCCCCAAATCTCAGGG + Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
983580043 4:169300395-169300417 GTGCCCTGATCAATGTCCCAGGG - Intergenic
987526229 5:19053427-19053449 GCACCTTGACCCATATCCCAGGG - Intergenic
987656318 5:20811886-20811908 TTGCCCTGCCAAATATCACAGGG + Intergenic
988767239 5:34392052-34392074 TTGCCCTGCCAAATATCACAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1003113165 6:3265574-3265596 ACACCCTGCCCTATATCCCAGGG - Intronic
1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG + Intergenic
1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG + Intergenic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1019336037 7:483297-483319 CCCGCCCGCCCAATATCCCACGG - Intergenic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG + Intergenic
1027206878 7:76107441-76107463 GCAGCCTGCCCAAAATCACATGG + Intergenic
1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG + Intergenic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1039341972 8:36660295-36660317 GGGCCATGCCAAATATGCCATGG + Intergenic
1043111878 8:76195572-76195594 GCCCACTGCCCAATGTCTCATGG - Intergenic
1049544837 8:143225770-143225792 GCACCCTGCCCAGCACCCCAAGG - Intergenic
1049954287 9:677874-677896 TAGCCCTGCCCAATATTTCACGG - Intronic
1052325921 9:27216716-27216738 CAGCCCTGCCCTAGATCCCAAGG - Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG + Intronic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG + Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1195138135 X:101931635-101931657 GCGCCCAGCCCAATCTCGGACGG + Intronic