ID: 990276409

View in Genome Browser
Species Human (GRCh38)
Location 5:54201665-54201687
Sequence CAAGTACAGCATGGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990276409_990276415 26 Left 990276409 5:54201665-54201687 CCTACCTCCCCATGCTGTACTTG 0: 1
1: 0
2: 5
3: 33
4: 238
Right 990276415 5:54201714-54201736 ACTGCAAGAACCCAATGCAGTGG 0: 1
1: 0
2: 17
3: 63
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990276409 Original CRISPR CAAGTACAGCATGGGGAGGT AGG (reversed) Intronic
900136371 1:1118863-1118885 CAGGTGCAGTATGGGAAGGTTGG + Intergenic
900878055 1:5360086-5360108 CAAATACAGCATAGGCAAGTGGG + Intergenic
901343095 1:8512963-8512985 CCAGCCCAGCCTGGGGAGGTTGG - Intronic
902670694 1:17971290-17971312 CAAGTGCAGCAGGGGTAGGAGGG - Intergenic
902821293 1:18944917-18944939 CAAGAAGAGCATGAGGAGGGAGG + Intronic
905976674 1:42180364-42180386 CAAGAAGAGCATGGGAAGGTGGG - Intronic
907868208 1:58419186-58419208 CAAGGAACTCATGGGGAGGTTGG - Intronic
908475771 1:64486740-64486762 CAAGCACAGCTTTGGGAGCTGGG + Intronic
909426717 1:75534072-75534094 CGAGTACTGCATGGGGATGATGG - Intronic
909687487 1:78366646-78366668 CAAATCCAGAATGGGCAGGTTGG - Intronic
909735063 1:78948497-78948519 AAAGCACAGCATATGGAGGTGGG + Intronic
909895138 1:81059188-81059210 AAAGGAAAGCATGGGGAAGTTGG - Intergenic
910149657 1:84126539-84126561 TGGGTACAGGATGGGGAGGTGGG + Intronic
910248300 1:85166504-85166526 CAAGTCCAGCAAGATGAGGTAGG + Intronic
910310867 1:85823011-85823033 CAAATATAGCATGGGCAAGTAGG - Intronic
910534680 1:88283743-88283765 CAAATACAGCATGGGTAAGTAGG + Intergenic
911416423 1:97580902-97580924 CAAATACAGAATGCGGAGGTAGG - Intronic
912178276 1:107187258-107187280 CAAGTACTGCATTGGGTGCTAGG - Intronic
913075725 1:115338830-115338852 CAAGTCCAGCATGGGGACAAGGG + Intergenic
914076475 1:144357137-144357159 TGAATACAGCATGGGGAAGTGGG + Intergenic
914102703 1:144609360-144609382 TGAATACAGCATGGGGAAGTGGG - Intergenic
914640365 1:149600438-149600460 TGAATACAGCATGGGGAAGTGGG - Intergenic
915485881 1:156220258-156220280 CAAGACCAGCATGGGCAGGCCGG - Intronic
915845594 1:159260785-159260807 CAAGGCCAGCACGGGGAGGGGGG - Intergenic
916100976 1:161392942-161392964 CAAGTACAACAGGGAGAGTTAGG - Intergenic
916369554 1:164074854-164074876 AAAGTAGAGCATGGGGATGTGGG + Intergenic
918568957 1:185964686-185964708 CAAGTACTACAGTGGGAGGTTGG + Intronic
920520784 1:206623963-206623985 AGAGAACAGCATGGGGTGGTGGG - Intergenic
921883543 1:220280354-220280376 CAAGTGCATCAGGGGGAGCTGGG - Intergenic
922133183 1:222799209-222799231 TGAGAACAGCATGGGGAGGGTGG + Intergenic
922247723 1:223817187-223817209 CAATTACTGCATGTGGAGGAGGG + Intronic
922371730 1:224917961-224917983 CAAGAAAAGCATGGTAAGGTTGG + Intronic
923318364 1:232804542-232804564 CAATTACAGCATGGACAAGTGGG + Intergenic
924825327 1:247532296-247532318 CATGTCCAGGAAGGGGAGGTTGG + Exonic
1066056672 10:31687975-31687997 CAAACACAGAATGGGGAGCTAGG + Intergenic
1066410334 10:35162584-35162606 CAAGGAAAGCATGTGGAGGTTGG - Intronic
1067147394 10:43703339-43703361 CAAGGACAGCATGCGAAGGCTGG + Intergenic
1067217166 10:44312768-44312790 CAGGCACAGCCTGAGGAGGTGGG - Intergenic
1067904474 10:50276340-50276362 CAAATACATCATGGAGAGGGAGG - Intergenic
1070793281 10:79202514-79202536 CAAGTACAGAGAGGGGAAGTGGG + Intronic
1072047624 10:91672529-91672551 CAAGTAGAGCATGGACAGATTGG + Intergenic
1072234063 10:93438224-93438246 CAGATACAGCATGGGCAAGTAGG - Intronic
1076692948 10:132233069-132233091 GAAGTAGAGCCTGGGGACGTGGG + Intronic
1080766014 11:35297362-35297384 CAAGTACAACATGGGTAAGTGGG - Intronic
1083707346 11:64525618-64525640 CGAGTTCAGCATCTGGAGGTGGG - Intergenic
1084711610 11:70847256-70847278 CAAGTACAGAGTGGGCAGGAGGG - Intronic
1086837489 11:91642968-91642990 CAAGTAAAGTAAGGGGAGGGGGG - Intergenic
1089587120 11:119517102-119517124 CAAGGACGGTGTGGGGAGGTGGG - Intergenic
1091981815 12:4870660-4870682 CAGGTACAGCTTTGGGATGTGGG + Intergenic
1093738952 12:22658630-22658652 CAAATACAGCATGGGCAAGTGGG + Intronic
1096595176 12:52690601-52690623 CAGGTACAGCAAAGGGAGCTTGG + Exonic
1096808730 12:54156407-54156429 TAATTGCACCATGGGGAGGTTGG - Intergenic
1097387220 12:58963841-58963863 CAAATACAGCATGGGCAAGTGGG - Intergenic
1097566263 12:61272621-61272643 CAAATACAACATGGGCAAGTAGG - Intergenic
1097902820 12:64890214-64890236 GAAGTACAGCAGGTAGAGGTGGG + Intergenic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1098965393 12:76782803-76782825 CAAATACAGCAAGGACAGGTGGG + Intronic
1099067022 12:77993780-77993802 CAAGAACAACATGGGGGTGTTGG - Intronic
1100674083 12:96847338-96847360 CAAGTAGAGCACAGGGAGGGAGG - Intronic
1100789938 12:98119412-98119434 CAACCACAGCATGGGGAAGCAGG + Intergenic
1101695515 12:107122102-107122124 CGAATACAGCATGAGCAGGTTGG - Intergenic
1103743503 12:123107047-123107069 GGGGTACAGCATGGGGAGGTGGG + Intronic
1105899960 13:24745546-24745568 CAAGTAGAGCACGGTGAAGTGGG + Intergenic
1106499610 13:30315364-30315386 CAGGTACAGTAGGGGAAGGTGGG - Intergenic
1107293438 13:38883658-38883680 CAAGGACAGCAAGTGGAGCTTGG - Exonic
1109060636 13:57615135-57615157 CATTAACAGCATTGGGAGGTTGG - Intergenic
1109089066 13:58016066-58016088 CAAATACAGCATGGGCAAGTGGG - Intergenic
1111524327 13:89448731-89448753 AAAACACAGCATGGGCAGGTTGG - Intergenic
1111661782 13:91220983-91221005 CAAATACAGCATGGGCAGGTGGG + Intergenic
1111738240 13:92169300-92169322 CATGTACAGGATGTGCAGGTTGG - Intronic
1112199108 13:97258088-97258110 CAAGTAAAGGAAGGGGCGGTAGG + Intronic
1112278663 13:98044020-98044042 CAAACACAGCATGGGCAAGTAGG + Intergenic
1113939429 13:114010708-114010730 GTAGTGCAGCATGGGGAGGAGGG + Intronic
1114535515 14:23419783-23419805 CATGGACAGAAAGGGGAGGTGGG + Intronic
1114724874 14:24925504-24925526 CAATTGCAGCACGGGGAGGGAGG + Intronic
1118324470 14:64771892-64771914 CCAGTGCAGCAGGGAGAGGTAGG - Intronic
1120557624 14:85948474-85948496 CAAGAACAGCACTGGGAGGTTGG + Intergenic
1121263252 14:92581830-92581852 CAAATACAGCATGGGCAAGTGGG + Intronic
1121328313 14:93034486-93034508 CAAGAATAGAATGGGGAGGCGGG + Intronic
1121338624 14:93092171-93092193 TAAGCCCAGCATGGGGAGGGTGG + Intronic
1121850905 14:97220177-97220199 TAATTACAGCAGGGAGAGGTTGG - Intergenic
1122039465 14:98973526-98973548 CAAGGACAGCATGGAGGGGATGG + Intergenic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1124017141 15:25886939-25886961 CTGGCACAGAATGGGGAGGTTGG - Intergenic
1126477887 15:49085569-49085591 CAAGTACAGCAATGAGAGGTGGG - Intergenic
1127056052 15:55133254-55133276 CAAGTACAGACAGGGGAGGATGG - Intergenic
1127380185 15:58424267-58424289 CAAGGACAGTTTGGGGAGGGGGG - Intronic
1131512836 15:93058878-93058900 CCAGGACTGCATAGGGAGGTTGG + Intronic
1132189994 15:99846258-99846280 CAGGTACACAATGGAGAGGTAGG - Intergenic
1134235939 16:12466628-12466650 CAGGTAGATCATGGTGAGGTAGG - Intronic
1137469863 16:48744597-48744619 CTTGTACAGCCTGGTGAGGTGGG - Intergenic
1137779703 16:51087683-51087705 CAAGTACACCATGGTGAGATGGG - Intergenic
1137879233 16:52029508-52029530 CAAGTACAGAATGGGGAAAAGGG + Intronic
1143633889 17:8153454-8153476 CAAGGATAGGTTGGGGAGGTGGG + Intronic
1144430147 17:15183734-15183756 CAAATACAGCATGGGCAAGTGGG - Intergenic
1144587120 17:16493561-16493583 CAATTACAGCATGGGCAAGTGGG + Intergenic
1144630975 17:16872356-16872378 CGAGTCCTGCATGGGGAGGGTGG - Intergenic
1144650338 17:17003120-17003142 CGAGTCCTGCATGGGGAGGGTGG + Intergenic
1144779446 17:17800501-17800523 CAGGGACAGGATGGGGTGGTCGG - Intronic
1144875757 17:18396308-18396330 CAAGCCCAGCCTGGGGGGGTGGG + Intergenic
1145086232 17:19943453-19943475 AAAGGACAGAATGGGGAGGGGGG + Intronic
1145156471 17:20548113-20548135 CAAGCCCAGCCTGGGGGGGTGGG - Intergenic
1147409913 17:40242852-40242874 GAAGTACAGCACTGGGAGATAGG - Intronic
1148684887 17:49495719-49495741 CAGGTACCGCAGGGGGCGGTGGG + Intronic
1149347007 17:55749101-55749123 GAAACACTGCATGGGGAGGTGGG + Intergenic
1149702643 17:58668225-58668247 AAAGTACAGCATGGGCAAATGGG - Intronic
1150939504 17:69675124-69675146 CAGGTACAGAAAGGGGAAGTTGG + Intergenic
1152131438 17:78479305-78479327 CAATTGCTTCATGGGGAGGTAGG - Intronic
1153095290 18:1394523-1394545 TGAGTACAGCATGGGCAAGTGGG + Intergenic
1153357133 18:4149792-4149814 CACGGACAGGGTGGGGAGGTGGG - Intronic
1156586311 18:38434841-38434863 CAAGTGCAGCCTTGGGATGTGGG - Intergenic
1156774625 18:40772010-40772032 CAAATATAGCATGGGGAGGTAGG - Intergenic
1157674398 18:49558307-49558329 CAAATACATCATAGGGAGTTAGG - Intergenic
1157780889 18:50438194-50438216 CAATGACAGAATAGGGAGGTTGG + Intergenic
1159872009 18:73768917-73768939 CAAATGCAGCATGGTGAGATGGG - Intergenic
1159923356 18:74246627-74246649 CAGGGAGAGTATGGGGAGGTGGG - Intergenic
1160060695 18:75526562-75526584 CAAGTAGAGTCTGGGGAGGTTGG + Intergenic
1160060717 18:75526673-75526695 CAAGTAGAGTCTGGGGAGGTTGG + Intergenic
1160168246 18:76531902-76531924 CAGGTACATCCTGGGTAGGTGGG + Intergenic
1161591531 19:5131331-5131353 CACGTACAGCATGGGGATGATGG - Exonic
1162318980 19:9959803-9959825 CAAGGTGAGCCTGGGGAGGTGGG + Exonic
1163244088 19:16081900-16081922 CACCTTCAGCCTGGGGAGGTCGG - Exonic
1164572877 19:29386799-29386821 CAAGTCCCACCTGGGGAGGTTGG + Intergenic
1165258281 19:34592966-34592988 AAAGGACAGCTTGGGTAGGTAGG + Intergenic
1165492362 19:36131862-36131884 CAAATACTGCATGGGGAAGTGGG + Intergenic
1165743479 19:38217208-38217230 CAATTAGAGCTTGGGGAGGGGGG - Intronic
1166541539 19:43608993-43609015 CAAAAACTCCATGGGGAGGTGGG + Intronic
1166641278 19:44497391-44497413 CAAGTACAGCATGAAGATGTAGG + Intronic
1166804165 19:45475041-45475063 CAAGTACAGCATGGGGTAGGGGG - Exonic
1167705684 19:51079659-51079681 CAAGCACAACCTGAGGAGGTGGG - Exonic
1168069368 19:53941369-53941391 CCAGGACAGAATGGGGAGGAGGG + Intronic
927516203 2:23672903-23672925 CCAGGGGAGCATGGGGAGGTGGG + Intronic
928241479 2:29590722-29590744 CAAATATAGCATGAGCAGGTGGG - Intronic
929028705 2:37630152-37630174 CACTTTCACCATGGGGAGGTGGG - Intergenic
929657071 2:43744517-43744539 TAAGTTCAGCATTGGGAGTTAGG + Intronic
930077702 2:47420601-47420623 CAAGTAAAGTATGGAAAGGTTGG - Intronic
932746183 2:74335444-74335466 GAAGTACAGCCTGGGGAGAGGGG - Intronic
932764125 2:74459521-74459543 CAAGTTCAGCTTGGAGAGATGGG - Intronic
934487088 2:94725495-94725517 GAAGCAAAGCAAGGGGAGGTGGG + Intergenic
936922001 2:117698347-117698369 CAAGTAGAGGATGGGGAGTTGGG - Intergenic
937170752 2:119865045-119865067 CAAGACTAGCATGGGGAGTTAGG - Intronic
938710992 2:133976179-133976201 CTAGTTGAGCATGTGGAGGTTGG + Intergenic
939602921 2:144216048-144216070 CAAGTAGAGTCTGGGGAAGTTGG - Intronic
939614865 2:144350698-144350720 CAAGTAAAGCCTGGAGAGGGAGG + Intergenic
940157692 2:150676570-150676592 CAATTACTGGATAGGGAGGTAGG + Intergenic
940898042 2:159099828-159099850 CAAATACCGCATGGGGAAGTGGG - Intronic
944451088 2:199843430-199843452 AAAATTCAGCATGGGGGGGTGGG - Intronic
945282490 2:208048812-208048834 GAAGCACAGCATGGGGAAGGAGG + Intergenic
945784360 2:214214601-214214623 CAAGTACATCATTTGGAGATGGG - Intronic
948090098 2:235286272-235286294 TAAGTAAAGGAAGGGGAGGTGGG - Intergenic
1168998921 20:2152574-2152596 GAAGTACAGTGTGGGGAGATGGG + Intronic
1169619694 20:7491586-7491608 CAAGTACAACATGGAGAGATGGG + Intergenic
1170743622 20:19079189-19079211 AAAGTACCTCATGGGGAGGAAGG + Intergenic
1172802081 20:37582809-37582831 CAAATACAGCATGGGCAAGTGGG + Intergenic
1173594764 20:44251547-44251569 CAAGTGCAGCATGGACAAGTTGG - Intronic
1175138164 20:56840456-56840478 CACGTAAAGAATGGGAAGGTGGG + Intergenic
1177403438 21:20636163-20636185 CGAATACAGCATGGGGAAGTGGG + Intergenic
1177827011 21:26095366-26095388 CATGTACAGCATGGAGACGCTGG - Intronic
1178141581 21:29690000-29690022 CAAGGAGAGGATGGGGAGGGAGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179813862 21:43890611-43890633 CAAGTTCAGCCTGGGCAGGGTGG - Intronic
1180851602 22:19024527-19024549 CGAATACAGCATGGGCAAGTGGG + Intergenic
1181683354 22:24511542-24511564 CAAGTACAGTAGCGAGAGGTGGG - Intronic
1182352678 22:29707628-29707650 CAAGTTCAGGATGGTGGGGTTGG + Intergenic
1182439503 22:30354513-30354535 CAAGAACAGAATTGGGCGGTGGG - Intronic
1184965192 22:47966313-47966335 CAAGTACAGCATGGGAAAGTGGG - Intergenic
949228843 3:1726728-1726750 CAAATACAGCATGGATAAGTGGG + Intergenic
950676014 3:14554993-14555015 CATCTACAGCACGGGGAGGAGGG - Intergenic
952830824 3:37563510-37563532 CACATCCAGAATGGGGAGGTGGG - Intronic
953237313 3:41117999-41118021 CAATTAGAGCATGGGGAGCAGGG + Intergenic
953414509 3:42707996-42708018 CAAGTTCACCATGGCGAGGGAGG + Intronic
953983168 3:47422865-47422887 CAAGAACCACATGCGGAGGTTGG - Intronic
954105758 3:48409091-48409113 CAAGTACAGCCTGGTGTGGCTGG - Intronic
955215850 3:56984403-56984425 CAAGCACATGATGGGTAGGTGGG + Intronic
955666636 3:61355991-61356013 CAAGCAGAGCAGGGGGAAGTGGG + Intergenic
956463507 3:69495409-69495431 CAAATACACCATGGGAAGGCAGG + Intronic
956500285 3:69875324-69875346 CAAGTCCCACATGGGAAGGTGGG - Intronic
956614811 3:71160122-71160144 CAAGAACAGCGTGGTGAGGATGG - Intronic
957562603 3:81842393-81842415 CAAGGAGAGCATGAGGATGTTGG - Intergenic
958521886 3:95201313-95201335 CAAGTACCGAATGTGTAGGTTGG + Intergenic
959740074 3:109708372-109708394 CCAGTATGGCAAGGGGAGGTAGG + Intergenic
959770561 3:110090292-110090314 CTAATACAGCAGGGAGAGGTGGG + Intergenic
959980940 3:112516817-112516839 CAAACACAGCATGGGCAAGTGGG - Intergenic
960571668 3:119190827-119190849 CAAGTACAGCTGGCTGAGGTTGG - Intronic
963774355 3:149423111-149423133 CAAGTACAGCATGGGCAAGTGGG + Intergenic
964979525 3:162662290-162662312 CAAACACAGCATGGGCAAGTGGG + Intergenic
965348241 3:167578968-167578990 CAAGAACAGCATGGGAAATTAGG - Intronic
965648250 3:170908011-170908033 CAGCTACTGCTTGGGGAGGTGGG + Intronic
965652373 3:170947407-170947429 CAAGCACAGCATGGGCAGGCCGG - Intergenic
968424437 4:512877-512899 AAAGAAGAGCATGGGGAGATGGG + Intronic
969689594 4:8696949-8696971 CATGTACAGCATGGAGATGCTGG - Intergenic
970359643 4:15296025-15296047 CAAGTAAAGCAAGTGGAGCTCGG - Intergenic
970471969 4:16387882-16387904 CAAATACAGCATGGGCAAGTGGG - Intergenic
971228994 4:24782526-24782548 CCAGAACAGCATGGGGAGAGAGG - Intergenic
971599662 4:28576165-28576187 TAAGTCAAGCATGGGGTGGTAGG - Intergenic
975808375 4:78137584-78137606 CAAGTACTGTCTGGGGAGGCTGG + Intronic
976194842 4:82522728-82522750 CAAATACAGCATGAGCAAGTGGG + Intronic
979689239 4:123543099-123543121 TAAATACAGCATGAGGAAGTAGG - Intergenic
981915115 4:150024821-150024843 CAAATAAAGCATGGGCAAGTGGG + Intergenic
982343521 4:154331114-154331136 CAAGGACAGCATGGCAAGGCAGG - Intronic
982612886 4:157599243-157599265 CAAATACAGCATGCACAGGTGGG + Intergenic
983801797 4:171940433-171940455 CAAGAACATAATGGGGAGTTTGG + Intronic
985181729 4:187272162-187272184 CAGGTACAGCTTTGGGATGTGGG + Intergenic
985294823 4:188425503-188425525 CAAGAGCAGGATGGGGAGGAAGG - Intergenic
985566123 5:618589-618611 CAAGTACAGCAGGGGCCGGGGGG + Intronic
987025648 5:13924152-13924174 TAGGGACAGCATGGGGAAGTGGG - Intronic
990276409 5:54201665-54201687 CAAGTACAGCATGGGGAGGTAGG - Intronic
990528405 5:56650853-56650875 CAAGTGGAGCAGGGGGTGGTGGG - Intergenic
991262760 5:64684872-64684894 CTAGTACAGAATTGGGAGATGGG - Intergenic
992542085 5:77775835-77775857 CAAGTTCAGCAAGGAGAGGCCGG + Intronic
993810174 5:92465940-92465962 TAAGTATAGCCTGGGGAAGTGGG - Intergenic
995287126 5:110402621-110402643 CAAGTACAGCTTAGGGAAATTGG + Intronic
995898707 5:117044740-117044762 CAAATACAGCATGGGCATCTGGG - Intergenic
996358944 5:122624402-122624424 CAAATACAGAATGGGCAAGTGGG - Intergenic
996549911 5:124719513-124719535 CAAAATCAGCATGGGGTGGTGGG + Intronic
997570103 5:134920864-134920886 CAAGTACAGCCTGGCCATGTTGG - Intronic
997986107 5:138502727-138502749 CAAGACCAGCCTGGGGAGGCTGG + Intergenic
1000097430 5:157984282-157984304 CAAATACAGCAGGGGCAAGTGGG + Intergenic
1002272578 5:178082296-178082318 CCAGTACAGCATGGGCGAGTGGG - Intergenic
1003245786 6:4380949-4380971 CCAGTACAACATGGGGATCTGGG + Intergenic
1005843380 6:29759179-29759201 CAAGCATAGCAAGGGGAGGATGG + Intergenic
1005897555 6:30190999-30191021 CAAGAGGAACATGGGGAGGTTGG + Intronic
1006743159 6:36323505-36323527 CAAGTCCAGCAGGAAGAGGTGGG - Exonic
1006815784 6:36848925-36848947 CAGGTACAGCCAGGGGAGGCAGG - Intergenic
1010783729 6:79975238-79975260 GAAGAACAGCCTGGGGAGGGAGG - Intergenic
1010905758 6:81486117-81486139 CCAGAACAGCATGGGGAGCTGGG - Intergenic
1015646244 6:135391845-135391867 CAAATACAGCATGGGCAAGTGGG + Intronic
1016028820 6:139316509-139316531 CAAATACAGCCTGGGCAAGTGGG - Intergenic
1016727714 6:147394658-147394680 CAAGTTCAGCATGGCTAGGGAGG + Intergenic
1017431365 6:154374353-154374375 CAAGAACAGGATGGGGAGAAGGG + Intronic
1020449761 7:8307645-8307667 TAAGTACAGGATAGGAAGGTTGG - Intergenic
1022258847 7:28685034-28685056 GAAAAACAGCCTGGGGAGGTGGG - Intronic
1023870666 7:44261480-44261502 CCAGGCCTGCATGGGGAGGTGGG - Intronic
1026862419 7:73799520-73799542 CGAATACAGCATGGGCAAGTGGG - Intronic
1027243165 7:76346645-76346667 CAAGAACGGCAAGGGCAGGTTGG - Intronic
1027987583 7:85313572-85313594 GGAGGACAGAATGGGGAGGTGGG - Intergenic
1028850318 7:95530502-95530524 CAAATACCTGATGGGGAGGTGGG + Intronic
1033674014 7:143519932-143519954 CTGGTCCAGCATGCGGAGGTGGG - Intergenic
1034255925 7:149724671-149724693 CAAGATCAGGATGGGGAGGAGGG - Exonic
1036658722 8:10693899-10693921 CAAGAGCTGCATGGAGAGGTGGG - Intronic
1037296559 8:17408092-17408114 CAAGAACATCATGGAGAGGCCGG + Intronic
1039375244 8:37026388-37026410 CAACTACAACATGGTGTGGTAGG - Intergenic
1039850304 8:41358975-41358997 CCAATACAGCATGGGCAAGTGGG + Intergenic
1040852996 8:51921425-51921447 CAAATACATCATGGGCAAGTGGG + Intergenic
1041131986 8:54710815-54710837 TAGGCACAGGATGGGGAGGTGGG + Intergenic
1041330007 8:56714246-56714268 CCAGTGCAGCCTGGGAAGGTGGG - Intergenic
1041652740 8:60317084-60317106 TGAGTACAGCATGGGCAAGTGGG - Intergenic
1042127278 8:65550818-65550840 AAAGTCCAGCATGGCAAGGTGGG - Intergenic
1046627036 8:116585959-116585981 CCAGTAAACCATGGGAAGGTTGG - Intergenic
1046877047 8:119266668-119266690 CAAGGACAGCAGGGAGAGGAAGG + Intergenic
1051464360 9:17360334-17360356 CTAATACAGCATGGGTAAGTGGG + Intronic
1052548825 9:29920555-29920577 CTAGTACACCATGGGGATTTAGG - Intergenic
1053537134 9:38937344-38937366 CAAATGCAGCATGGGCAAGTGGG + Intergenic
1053545451 9:39018629-39018651 TGAATACAGCATGGGCAGGTGGG + Intergenic
1053809782 9:41840327-41840349 TGAATACAGCATGGGCAGGTGGG + Intergenic
1054620811 9:67347101-67347123 TGAATACAGCATGGGCAGGTGGG - Intergenic
1054629001 9:67426586-67426608 CAAATACAGCATGGGCAAGTGGG - Intergenic
1054756733 9:68966312-68966334 AAAGTACAGCATGGAAAGGGAGG + Intronic
1056493192 9:87128468-87128490 CATGTGCAGCATGGGCTGGTGGG + Intergenic
1058522518 9:105825603-105825625 CAAGACCAGCATGGGGAACTTGG - Intergenic
1058953702 9:109926526-109926548 TGGGTACAGCATGGGGAGGATGG + Intronic
1059350268 9:113659395-113659417 CTAAGACAGCATGGGCAGGTGGG + Intergenic
1060509357 9:124220875-124220897 CCACTGCAGCATGGGGAGGGAGG + Intergenic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1062372866 9:136249179-136249201 CTAGGACACCATGAGGAGGTGGG + Intergenic
1062570682 9:137183735-137183757 CAAGTACTGCCTGGAGAGGACGG - Exonic
1185951111 X:4435308-4435330 CAAATACAGCTTGGTGAGTTTGG - Intergenic
1189861228 X:45274761-45274783 CAAATACAGCATGAGCAAGTGGG - Intergenic
1192811729 X:74553127-74553149 CAAATACAGCATGGGCCAGTGGG + Intergenic
1193091899 X:77502539-77502561 ACAATACAGCATGGAGAGGTTGG - Intergenic
1194337088 X:92661057-92661079 CAAATACAGCAAGGGAAGCTGGG - Intergenic
1195990404 X:110676897-110676919 TAAGGACAGCATGTGGACGTAGG - Intronic
1196885020 X:120236209-120236231 CAAGGACAGCATGGGAAGCCTGG - Intergenic
1198053785 X:132974479-132974501 CAAGAACAGAATGGAGAGATGGG - Intergenic
1198550853 X:137743537-137743559 CAAATAGAGCATGGGCAAGTGGG + Intergenic
1200760182 Y:7030618-7030640 CTTGTACAGCATGGGTATGTGGG - Intronic
1201609375 Y:15823676-15823698 CAGGCACAGAATGGGGAGGTGGG + Intergenic