ID: 990278846

View in Genome Browser
Species Human (GRCh38)
Location 5:54228401-54228423
Sequence TATTCAGGACTAGCTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990278844_990278846 -1 Left 990278844 5:54228379-54228401 CCAGGGGGTAGAATAGGTTCAAT 0: 1
1: 0
2: 0
3: 3
4: 62
Right 990278846 5:54228401-54228423 TATTCAGGACTAGCTCAAACAGG No data
990278843_990278846 0 Left 990278843 5:54228378-54228400 CCCAGGGGGTAGAATAGGTTCAA 0: 1
1: 0
2: 0
3: 3
4: 120
Right 990278846 5:54228401-54228423 TATTCAGGACTAGCTCAAACAGG No data
990278838_990278846 16 Left 990278838 5:54228362-54228384 CCAAATTCTGCATAAACCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 125
Right 990278846 5:54228401-54228423 TATTCAGGACTAGCTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990278846 Original CRISPR TATTCAGGACTAGCTCAAAC AGG Intronic
No off target data available for this crispr