ID: 990282179

View in Genome Browser
Species Human (GRCh38)
Location 5:54262981-54263003
Sequence TGAATTCATTTGGATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282179 Original CRISPR TGAATTCATTTGGATGGGGT GGG Intronic
901325559 1:8363221-8363243 TGATTTCATTTGGTTTGGTTGGG - Intronic
902980277 1:20117776-20117798 TGACTTCATTTGCCTGAGGTTGG - Intronic
905247346 1:36624325-36624347 TGAATCCTTTTTGATGGGATGGG + Intergenic
905845297 1:41225578-41225600 TCAATTCCTTTGGATGGAATTGG - Intronic
906038891 1:42770982-42771004 TACTGTCATTTGGATGGGGTAGG - Intronic
907017025 1:51026240-51026262 TTAATTCATTGTGATGTGGTTGG - Intergenic
911923587 1:103798001-103798023 TGAAATCATGTGGATGGAATGGG + Intergenic
911926216 1:103835637-103835659 TGAAATCATCTGGAAGGGGGAGG + Intergenic
912105071 1:106263745-106263767 TGAATTCACTTTCATTGGGTTGG + Intergenic
913716926 1:121544994-121545016 TGAATTAATTTAAATGAGGTAGG + Intergenic
913978796 1:143488910-143488932 TGAATTCTGTGGGCTGGGGTGGG + Intergenic
914398238 1:147291063-147291085 TTACTTGATTTGGATGGGGTAGG + Intronic
915119057 1:153617200-153617222 TGAAGTCACTGGGAGGGGGTAGG + Intergenic
918159960 1:181889295-181889317 TGAATTCTCTTGGTTGGGGGAGG - Intergenic
919710810 1:200726241-200726263 GGAAGTAATTTGGATGGGGGAGG + Intergenic
920742418 1:208593932-208593954 TTAATTCAGTAGGTTGGGGTGGG + Intergenic
921867857 1:220105523-220105545 TGAAGTAATTTGTATGGGGTAGG + Intronic
922118870 1:222643009-222643031 GCAATTTTTTTGGATGGGGTTGG + Intronic
923280677 1:232440153-232440175 TCAATGCTTTTGGTTGGGGTGGG + Intronic
923354611 1:233141841-233141863 AGAATTCATTCGAATGGGCTAGG + Intronic
1063832567 10:9971591-9971613 TAGATTTATTTGGATTGGGTTGG - Intergenic
1067423929 10:46186889-46186911 TTAATATATTTGGATGGGATGGG - Intergenic
1067943443 10:50675515-50675537 AGAAATCATTTGAATGCGGTAGG - Intergenic
1070864771 10:79701266-79701288 AGAAATCATTTGAATGCGGTAGG - Intergenic
1070878559 10:79839394-79839416 AGAAATCATTTGAATGCGGTAGG - Intergenic
1071426863 10:85566031-85566053 TCCATTCATATGGCTGGGGTAGG - Intergenic
1071631670 10:87223484-87223506 AGAAATCATTTGAATGCGGTAGG - Intergenic
1071645116 10:87355704-87355726 AGAAATCATTTGAATGCGGTAGG - Intergenic
1071678102 10:87675873-87675895 TGCTTTCATTTGCATGGGGAAGG - Intronic
1072697523 10:97614928-97614950 TGAATTCATACGGATGGCTTGGG - Exonic
1073925057 10:108505475-108505497 TGCATTCCTTTGGAGGGGGAGGG - Intergenic
1075247444 10:120835865-120835887 TGAATGAAGATGGATGGGGTAGG + Intergenic
1075649532 10:124118641-124118663 TGACTCCATTTGATTGGGGTGGG - Intergenic
1077754822 11:5015557-5015579 TGTAATCATTGGGATTGGGTTGG + Intergenic
1079681921 11:23307582-23307604 TGACTTCATAGGGTTGGGGTAGG + Intergenic
1083547696 11:63561166-63561188 TGAAGTAATTTGGATGGAATTGG + Intronic
1086272043 11:85079455-85079477 TCAATTCAGTTGGTTGGGGGAGG + Intronic
1088938376 11:114427092-114427114 TGAATTTTTTTGGGGGGGGTAGG - Intronic
1089065973 11:115662293-115662315 TCACTTCATTTGTATGGGTTGGG - Intergenic
1090702140 11:129306096-129306118 TGTGATCATTTGGATGGGGAAGG - Intergenic
1092762003 12:11818910-11818932 TGAATGCATGTGGGTAGGGTAGG - Intronic
1093243305 12:16704915-16704937 TGTATTCATTTGGATAGTCTAGG + Intergenic
1097506835 12:60484152-60484174 TGAATTCAGTGGGCTGGGGAAGG + Intergenic
1098428682 12:70395243-70395265 TGACTTCATTTGGTTAGGGAGGG - Intronic
1100871050 12:98910740-98910762 TGAAGACATTTGGATGGTGTTGG - Intronic
1101401074 12:104387410-104387432 TTATTTCATCTGGCTGGGGTTGG + Intergenic
1101805475 12:108059892-108059914 TGACTGCATTTGGATGTGTTAGG + Intergenic
1104343254 12:127971835-127971857 AGAATCCATTTGGCAGGGGTGGG - Intergenic
1105391388 13:19982202-19982224 TGGATTTATTTGGATGGGAAAGG + Intronic
1107263228 13:38519898-38519920 AGAATTAGTTTGGAAGGGGTAGG + Intergenic
1109446225 13:62444870-62444892 AGAATTCATTGTGATAGGGTAGG + Intergenic
1111568138 13:90043526-90043548 TGAATTAATTGGTTTGGGGTAGG + Intergenic
1112253817 13:97809114-97809136 TGAAATGGTTTGGGTGGGGTGGG + Intergenic
1112667951 13:101598335-101598357 TGAATTCATTTGAATTGTGATGG - Intronic
1113073387 13:106444504-106444526 CGACTTCATTTGGCGGGGGTGGG - Intergenic
1114401719 14:22416349-22416371 TGATTTCATTAGTCTGGGGTGGG - Intergenic
1116340456 14:43716371-43716393 TGAATTCATTACTATGGGGAGGG + Intergenic
1117543195 14:56768779-56768801 TGAAGTCATTTGCATGGTGGTGG + Intergenic
1119368402 14:74115945-74115967 TAAATTAATTTGGATGGTGTTGG + Intronic
1120477833 14:85010320-85010342 TGAATTCACATGGCTGGGTTTGG - Intergenic
1120555785 14:85928917-85928939 TGATTTCATTTTGATAGTGTGGG + Intergenic
1121706617 14:96000897-96000919 TGAATTTCTTTGGATGGTTTTGG - Intergenic
1123774268 15:23562682-23562704 TGAAGACATTTGGATAGGATGGG + Intergenic
1124925960 15:34070858-34070880 TGAATTAATGTGCATGAGGTGGG + Intergenic
1125953692 15:43775506-43775528 TGAGGTACTTTGGATGGGGTGGG - Exonic
1126311130 15:47318152-47318174 TGAATTAATTTAAATGAGGTAGG + Intronic
1126593295 15:50360857-50360879 TGAATGCATTTGGCTGGGTGTGG - Intergenic
1128911338 15:71518214-71518236 TGAGTACATTTGGAAGGGGTGGG - Intronic
1129627962 15:77224964-77224986 TGATTGCATATGGATGGAGTGGG - Intronic
1135038052 16:19094751-19094773 TGAATTCAACGGGTTGGGGTAGG + Intergenic
1135943208 16:26840818-26840840 TTAATTGATTTGGATGAGATTGG - Intergenic
1137582580 16:49642668-49642690 AAAATGCATTTGGAGGGGGTGGG - Intronic
1137907162 16:52334486-52334508 TGCATTCCTTTGGAGGGGGAGGG - Intergenic
1138797231 16:59983613-59983635 TGGATTCATTAAGCTGGGGTGGG - Intergenic
1138873698 16:60924204-60924226 AGAAATCATTTGGCTGGGGATGG + Intergenic
1138965044 16:62074040-62074062 TAAAATCATTTTGATGGGGGAGG - Intergenic
1140520274 16:75575057-75575079 TGATTTCATTGGTCTGGGGTAGG + Intronic
1140768797 16:78184281-78184303 TGAATTTACGGGGATGGGGTGGG + Intronic
1140997203 16:80272522-80272544 TGAATTCATTGTGATAGTGTAGG - Intergenic
1143437056 17:6936919-6936941 TGAATTCATTTGGAACTGGCTGG + Intronic
1145751239 17:27356527-27356549 TGAGTTCAATGGGGTGGGGTGGG - Intergenic
1145962494 17:28895725-28895747 CCTTTTCATTTGGATGGGGTCGG - Intronic
1146070617 17:29677673-29677695 CTAATTCATTTGGATGGTGATGG - Exonic
1146127361 17:30239579-30239601 TTGCTTCATCTGGATGGGGTGGG - Intergenic
1148462132 17:47844963-47844985 TGAACTCACTTTGAGGGGGTAGG - Exonic
1148650847 17:49249244-49249266 TGAAGTCTGCTGGATGGGGTGGG - Intergenic
1150381550 17:64724302-64724324 TGAATTCATTTTTCAGGGGTGGG + Intergenic
1150774783 17:68070936-68070958 TGAATTCATTTTTCAGGGGTGGG - Intergenic
1150943109 17:69714875-69714897 TGTGTTCTTTTGGAAGGGGTGGG + Intergenic
1151241755 17:72763885-72763907 TGGGTTCATCTGGATGGAGTGGG - Intronic
1151511450 17:74563081-74563103 GGCATCCATTGGGATGGGGTTGG - Intergenic
1155460166 18:26070778-26070800 TCATTTCAGTTGAATGGGGTGGG - Intronic
1156098653 18:33566381-33566403 TGCAGTCATTGGGGTGGGGTGGG + Intergenic
1156112900 18:33748737-33748759 TGAATGAATTTGGAAGGAGTTGG - Exonic
1157650271 18:49322038-49322060 TGAATTCATTGTGATGGGTATGG - Intronic
1158226418 18:55205996-55206018 TGATTTCATTTGTCTGGGATGGG - Intergenic
1159634878 18:70792663-70792685 TGAATTCATATGGAAGGAGATGG + Intergenic
1160613735 18:80108919-80108941 TGACTTCATTTGCATGGAATGGG - Intergenic
1161458963 19:4385241-4385263 TGGCTTCCTTGGGATGGGGTGGG + Intronic
1161893849 19:7065039-7065061 TGTATACATTTTGATGGGTTTGG + Intergenic
1167734595 19:51285059-51285081 TGTCTTCATTTGGATTGGCTGGG + Intergenic
925070911 2:965696-965718 GGAATTCCACTGGATGGGGTGGG + Intronic
925177748 2:1797133-1797155 TGAATCCAGTTGAATGGGGTTGG + Intronic
925703643 2:6663427-6663449 TGAAATAATTTGAATGGTGTTGG + Intergenic
925885316 2:8390485-8390507 TACATACCTTTGGATGGGGTGGG + Intergenic
928538078 2:32259050-32259072 GGAACTCATGTGGATGGGGTTGG + Intronic
929901055 2:46004220-46004242 TTCATCCTTTTGGATGGGGTTGG + Intronic
930204554 2:48575356-48575378 TAAATTCTTTTGGATAGGCTGGG + Intronic
933171254 2:79128306-79128328 TGCAGTCATTTTGATGGTGTGGG + Intergenic
933385437 2:81604935-81604957 TGAATTCATTTCTATAGGTTTGG + Intergenic
934183520 2:89649991-89650013 TGAATTCTGTGGGCTGGGGTGGG + Intergenic
935823984 2:106923634-106923656 TCAATTCATGTGTATGGGATGGG + Intergenic
938505229 2:131873150-131873172 TGAATTCATTTGCATGGAGTCGG - Intergenic
938628453 2:133137986-133138008 TGATTTTTTTTAGATGGGGTAGG + Intronic
938739789 2:134220322-134220344 TCATTTCATTTGGTCGGGGTGGG - Intronic
942356705 2:175122475-175122497 GGAATTCATTTTGATGGTTTGGG - Intronic
942714516 2:178876182-178876204 TGAATTCATTTGGAAGAGTTAGG - Intronic
943467971 2:188253967-188253989 ACAATTCTTTTGCATGGGGTGGG + Intergenic
943750993 2:191509364-191509386 TAAATTCATTTGGGTAGGTTTGG + Intergenic
943753063 2:191529947-191529969 TGAGTTCATTTGGCTGGGCACGG - Intergenic
944412166 2:199456383-199456405 TCCATTCATTGGGACGGGGTTGG + Intronic
945156385 2:206843943-206843965 TGAATAAATTTTGGTGGGGTGGG - Intergenic
945889638 2:215414882-215414904 TGCATTCCACTGGATGGGGTGGG + Exonic
945895901 2:215481443-215481465 TCAATTCATTTGCATGGGGGAGG + Intergenic
1173037019 20:39422009-39422031 TGAATTCCTTTAAATGGGATTGG + Intergenic
1173434601 20:43021471-43021493 TGAACTCAGTTGGATGGGGTAGG + Intronic
1173883243 20:46435017-46435039 TGTACTCATTTGGTTGGGTTGGG + Intergenic
1174801681 20:53568928-53568950 AGAAATCATTTGGGTTGGGTGGG - Exonic
1175217425 20:57398924-57398946 TGATCTCATTTGGATAGAGTAGG + Intronic
1175805244 20:61824386-61824408 TTAATTCATGTCGCTGGGGTTGG - Intronic
1176787868 21:13280729-13280751 TGAAGTCATTTGCATGGAGTCGG + Intergenic
1176897842 21:14403967-14403989 TGAATTCAGTTAGATGGAGAAGG - Intergenic
1176910625 21:14560777-14560799 TGTATACATTTACATGGGGTGGG - Intronic
1176910790 21:14562119-14562141 TGTATACATTTACATGGGGTGGG + Intronic
1179088898 21:38245303-38245325 TGATTTCATTGGTCTGGGGTGGG - Intronic
1179887652 21:44321235-44321257 TGGATTCACATGGATGTGGTGGG + Intronic
1183677910 22:39310046-39310068 TGGAGTCATGTGGGTGGGGTCGG - Intergenic
949185404 3:1185980-1186002 TGAATTGTTTTGGATGTAGTAGG - Intronic
949801267 3:7906567-7906589 TGACTTCCTTTGGCTGGGGGAGG + Intergenic
949807899 3:7975480-7975502 GGAATTTGATTGGATGGGGTAGG - Intergenic
950680386 3:14581215-14581237 TCAGTTCATTTGGATGAGGAGGG - Intergenic
952682903 3:36116483-36116505 TGATTTCCTTTTGTTGGGGTGGG - Intergenic
953213757 3:40898630-40898652 TCAATTCATTTGGTTGGGTGGGG - Intergenic
955212510 3:56955117-56955139 TGAATTTAAGGGGATGGGGTGGG - Intronic
955968227 3:64410656-64410678 TGAATTCCTCTGGTTGGGGAGGG - Intronic
956478980 3:69653640-69653662 TGAATCCCTAGGGATGGGGTGGG - Intergenic
957900579 3:86483212-86483234 TGAATTCATTACAATGGGGAGGG - Intergenic
962777088 3:138671888-138671910 TGAATTTTTTTAGATAGGGTGGG + Intronic
964777942 3:160299831-160299853 GGAGGTCATTTGGAGGGGGTCGG - Intronic
965218266 3:165893022-165893044 TGAAATAATTTTGAAGGGGTGGG - Intergenic
965332390 3:167391928-167391950 TGATTTCAAGTGGATGGGATAGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969929544 4:10617185-10617207 TGTATGCATTGGGATGGGGAGGG - Intronic
971670419 4:29548107-29548129 TGAATTCAGTTCCATGTGGTTGG - Intergenic
974255307 4:59445625-59445647 TTAATTAATTTGGACTGGGTGGG + Intergenic
974323225 4:60379486-60379508 TGAATCCATTTGAATTGGATTGG - Intergenic
974615813 4:64279836-64279858 TGAATGTATTTGCATGGGATTGG - Exonic
975254493 4:72216899-72216921 TGGGTTCATTTGTGTGGGGTTGG - Intergenic
975519588 4:75286211-75286233 TGATTTCATTGGAATGGGATGGG - Intergenic
978777421 4:112516976-112516998 TGGATTCATTTGGTTAGGGGAGG + Intergenic
980659989 4:135844995-135845017 TGAACTTACTTGGATGGGGAGGG - Intergenic
982151931 4:152468268-152468290 TGAGTATATATGGATGGGGTGGG - Intronic
983034927 4:162852028-162852050 TGAATTTATTTCCATGGGGGCGG + Intergenic
983075921 4:163326546-163326568 TGAATTCATTTTGATTGGTTTGG + Exonic
983625316 4:169796329-169796351 TCAAAACAGTTGGATGGGGTCGG - Intergenic
983806664 4:172001991-172002013 GGACTTCATTTGGATGGCTTGGG - Intronic
983995567 4:174177248-174177270 TAAATACAGTTGGATGGGGATGG - Intergenic
984506430 4:180624697-180624719 TTAATTTATTTGGATGGATTTGG + Intergenic
987623582 5:20367968-20367990 TGAATTAATTTGTCTGGGGCAGG + Intronic
988923436 5:35964854-35964876 TGACTTGATTTGTCTGGGGTGGG - Intronic
988925998 5:35991470-35991492 TGAAGTCAGTAGGAGGGGGTTGG + Exonic
989108939 5:37888835-37888857 TGAATATCTTTGGAAGGGGTTGG - Intergenic
989298470 5:39859852-39859874 TGAATTGACTAGGATGGGGATGG - Intergenic
989961637 5:50422787-50422809 TGAATTAATTTAAATGAGGTAGG - Intronic
990282179 5:54262981-54263003 TGAATTCATTTGGATGGGGTGGG + Intronic
990389961 5:55308512-55308534 TGAATTGATTTGGAGGGGAAAGG + Intronic
993756333 5:91734893-91734915 TGATTTCATATGGTTGAGGTGGG + Intergenic
997229440 5:132231957-132231979 TGAATGCAATTTGGTGGGGTTGG + Intronic
997355423 5:133259787-133259809 GGAAATAGTTTGGATGGGGTGGG + Intronic
998699328 5:144679667-144679689 TGAATTGTTTTGGCTGGGGGTGG - Intergenic
999092932 5:148953453-148953475 AGAATTCACTTGGGTGGGGAAGG + Intronic
999195979 5:149782032-149782054 TAAATTAATTTAGATGGGGATGG + Intronic
1000106776 5:158067347-158067369 TTTCTTCATTTGGTTGGGGTTGG - Intergenic
1000485284 5:161834123-161834145 TGTAATCACTAGGATGGGGTGGG - Intergenic
1001181904 5:169528220-169528242 TGAATTCATTTGTCAGAGGTTGG + Intergenic
1001376910 5:171268547-171268569 TTACTGCATTTGGGTGGGGTGGG - Intronic
1003364759 6:5461911-5461933 TGATTTCATTTCTTTGGGGTAGG + Intronic
1003695436 6:8402096-8402118 TGAATTCAATAGGGTTGGGTGGG - Intergenic
1004634134 6:17450418-17450440 TGACATATTTTGGATGGGGTTGG + Intronic
1009038395 6:58146330-58146352 TGAATTGTTTTGGAGGGGGTCGG - Intergenic
1009214188 6:60899985-60900007 TGAATTGTTTTGGAGGCGGTCGG - Intergenic
1009506436 6:64486391-64486413 TGAATTCTTTTGGATTTTGTTGG - Intronic
1010503899 6:76632849-76632871 TGTATCCATTTTGATGGGTTTGG - Intergenic
1010584733 6:77643714-77643736 TCCATTCATTTGGTTGGGGGTGG + Intergenic
1010638892 6:78297207-78297229 TGAATTTATTTTGTTGGGGTGGG + Intergenic
1011332985 6:86230763-86230785 TGGATTCATTTGAGTAGGGTTGG + Intergenic
1012685399 6:102241940-102241962 TGATTTTATTATGATGGGGTGGG + Intergenic
1013071844 6:106736600-106736622 TGAAATCTTCTGGATGGGCTGGG - Intergenic
1013249526 6:108320506-108320528 TGGATCCATTTGGTAGGGGTTGG + Intronic
1013659421 6:112279761-112279783 TGATTTCATTTGGGTGGAGAAGG - Intergenic
1013924265 6:115449738-115449760 TGAGTTTATGTGTATGGGGTTGG + Intergenic
1015344121 6:132135594-132135616 TCATTTCATATGGGTGGGGTGGG - Intergenic
1016019683 6:139223328-139223350 TGCATTTATTGGGATGGGGAAGG + Intergenic
1016182499 6:141164448-141164470 TGAATTCATTGAGATGGTGGGGG - Intergenic
1016927647 6:149367848-149367870 AGGATTGATTTGGATGGGGGAGG + Intronic
1018022028 6:159770513-159770535 AGAATTCACTGGGATGGGGCCGG + Intronic
1020287869 7:6699478-6699500 TGGATTCATCTGGCTGGGGTGGG - Intronic
1021631472 7:22651752-22651774 TGACTTCATTGGCATGGGGTGGG - Intergenic
1022966914 7:35482538-35482560 TGAATTCATGAGGGTGGGGGAGG + Intergenic
1023484926 7:40676050-40676072 TGATTAGATTTGGATGGGGTTGG + Intronic
1023790339 7:43748997-43749019 TGATTTGATTTGGAGGGAGTAGG - Intergenic
1023937752 7:44751333-44751355 TGAAGTCAGTAGGATGGGCTGGG - Intronic
1023955373 7:44882851-44882873 GGAATACCTTTTGATGGGGTGGG + Exonic
1024608350 7:51041361-51041383 TGAGTTCATATGAATAGGGTTGG + Intronic
1030887526 7:114956691-114956713 TAAATTCATTGGTCTGGGGTGGG - Intronic
1032285134 7:130533967-130533989 TGAATTTATTGGGGTGGGGTGGG + Intronic
1033838647 7:145346919-145346941 TGAAATCATTTGGCTGGTTTTGG - Intergenic
1038535263 8:28349038-28349060 TGACTTCATCTGGGTGGGGTCGG + Intronic
1039256188 8:35721443-35721465 TGCATTCAATAGGATGGAGTAGG + Intronic
1040698606 8:50034178-50034200 TGAATTTATTTGGATTGAGAAGG - Intronic
1043871476 8:85438496-85438518 TGCATTCTTGGGGATGGGGTGGG - Intronic
1045943920 8:107773025-107773047 TGGTTTGCTTTGGATGGGGTGGG - Intergenic
1046023754 8:108697721-108697743 TGAATTAATTTGGCTGGGTATGG + Intronic
1048205723 8:132413893-132413915 TGAATTCATTTGTCATGGGTGGG - Intronic
1048215977 8:132495245-132495267 TGAATCCACTGGGAAGGGGTAGG + Intergenic
1050283305 9:4075190-4075212 TGTATACATTTTGATGAGGTTGG - Intronic
1051376456 9:16407443-16407465 TGATTTGATTTGGGTGGGGGCGG - Intergenic
1052445115 9:28551712-28551734 TTAATTTATTTGGATGGGGAAGG + Intronic
1053014029 9:34651770-34651792 TGATTTAATTGGTATGGGGTGGG + Exonic
1056498892 9:87188856-87188878 TGAATTGATTGGTCTGGGGTGGG - Intergenic
1057380187 9:94560337-94560359 TGAATTGAAATGAATGGGGTTGG + Intronic
1059022603 9:110592766-110592788 TGCATTCAGTGGGATGGGCTGGG + Intergenic
1061110155 9:128563633-128563655 TGAATTCATTTGTAAGGGGTAGG - Intronic
1061492611 9:130954424-130954446 GGGATTGGTTTGGATGGGGTGGG - Intergenic
1186713714 X:12227973-12227995 TGAATCAATTTTGTTGGGGTTGG - Intronic
1187084964 X:16032856-16032878 TAAATTAATTTGGGTGGGGGAGG - Intergenic
1188895791 X:35667079-35667101 TGTATTCATTTGCATTGAGTTGG - Intergenic
1188920778 X:35974028-35974050 AGATTACATTTGGCTGGGGTGGG + Intronic
1189544297 X:42025707-42025729 TGAATTCATTTGGACTTGGCAGG + Intergenic
1191890675 X:65936869-65936891 TGCATTCCTTTGGAGGAGGTGGG - Intergenic
1191998105 X:67118269-67118291 TGATTTAAATGGGATGGGGTGGG - Intergenic
1195942898 X:110179943-110179965 TGAATTCTCCTGGATGGGGCTGG + Intronic
1197441136 X:126492992-126493014 TTAATTCATAAGGATGGGTTTGG - Intergenic
1198566509 X:137910724-137910746 TGAATTGCAGTGGATGGGGTGGG - Intergenic
1198635229 X:138690739-138690761 TGAATGCCTTGGGATGGGGGTGG - Intronic
1199010869 X:142757154-142757176 TGACTTCATTTATTTGGGGTAGG + Intergenic
1199577361 X:149325468-149325490 GGAATTTATTTGGATGGGAGAGG - Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic
1200414710 Y:2897181-2897203 GCAATTTAATTGGATGGGGTCGG + Intronic