ID: 990282588

View in Genome Browser
Species Human (GRCh38)
Location 5:54267376-54267398
Sequence AGAGCTCTGGCCAGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7333
Summary {0: 1, 1: 13, 2: 134, 3: 1152, 4: 6033}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282588 Original CRISPR AGAGCTCTGGCCAGGCGCGG TGG (reversed) Intronic
Too many off-targets to display for this crispr