ID: 990282856

View in Genome Browser
Species Human (GRCh38)
Location 5:54270440-54270462
Sequence TTATGGTAGGTAGCAGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990282856_990282865 18 Left 990282856 5:54270440-54270462 CCTATCACTGCTACCTACCATAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data
990282856_990282859 2 Left 990282856 5:54270440-54270462 CCTATCACTGCTACCTACCATAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 990282859 5:54270465-54270487 TAGAATGCCCACGTATCCCCAGG 0: 1
1: 0
2: 1
3: 0
4: 53
990282856_990282861 4 Left 990282856 5:54270440-54270462 CCTATCACTGCTACCTACCATAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 990282861 5:54270467-54270489 GAATGCCCACGTATCCCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
990282856_990282860 3 Left 990282856 5:54270440-54270462 CCTATCACTGCTACCTACCATAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 990282860 5:54270466-54270488 AGAATGCCCACGTATCCCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282856 Original CRISPR TTATGGTAGGTAGCAGTGAT AGG (reversed) Intronic
904890356 1:33774839-33774861 TGATGGTAGGAGGAAGTGATGGG - Intronic
905762121 1:40568119-40568141 ATATGGTTGAAAGCAGTGATTGG - Intergenic
907591056 1:55671641-55671663 TTATGGTAGGGAGCAGTTCTGGG + Intergenic
908988007 1:70048814-70048836 TTATTTTTGGTAGCAGTGAAAGG + Intronic
909278344 1:73717815-73717837 TTATGTCAGATAACAGTGATTGG - Intergenic
909910743 1:81255071-81255093 TTATGTTAGGAACCAGTGCTAGG - Intergenic
914243626 1:145870000-145870022 TAATGGTAACTAGCAGTAATAGG + Intronic
914995403 1:152539098-152539120 TCATGGTCAGTAGTAGTGATAGG + Intronic
917059384 1:171019948-171019970 TGATGGTAGTTTGCAGTGCTGGG - Intronic
917449658 1:175136609-175136631 CTATGGAAGGGAGCAGTGAAGGG - Intronic
918833528 1:189429945-189429967 TTATGGTAGGCAGCACTAAGTGG + Intergenic
918998628 1:191797186-191797208 TGATGGTAGGTACAATTGATGGG - Intergenic
921541013 1:216415767-216415789 TTTTGGGAGGTAGAAGTGAACGG - Intronic
923022583 1:230176192-230176214 TTATAGTAGGCATCATTGATTGG + Intronic
923085047 1:230696826-230696848 TTCTGGTAGGTTGCAGTGGAGGG - Intergenic
923518022 1:234713753-234713775 TGGTGGTTGGTAGCAGTGAGTGG + Intergenic
1065753440 10:28909476-28909498 CTGTGGTAGGTATCAGTCATTGG + Intergenic
1067514643 10:46927763-46927785 TTTTGCTTGGTAACAGTGATTGG + Intronic
1067647617 10:48124050-48124072 TTTTGCTTGGTAACAGTGATTGG - Intergenic
1069524435 10:69155207-69155229 TTATGGTGGGTAGCAGACTTAGG + Intronic
1069843565 10:71355310-71355332 CTCTGTTAGGTAGCAGTGAAAGG + Intronic
1077525932 11:3064874-3064896 TTTTGGGAGGTTGCAGTGAGTGG - Intergenic
1084049616 11:66591296-66591318 TTTTGGTAGCTTGGAGTGATGGG + Exonic
1085462999 11:76706543-76706565 TAATGGTGGGTAGCAGAGCTAGG - Intergenic
1086959249 11:92965802-92965824 TCTTGGGAGATAGCAGTGATTGG - Intergenic
1093232983 12:16571140-16571162 TTAAGGTAAGTAGCAGGGTTTGG + Intronic
1093500209 12:19803172-19803194 TTATGGTAGGTGGCAGAGACTGG + Intergenic
1099251958 12:80267323-80267345 TTATGGTAGGTTTCAATGATGGG + Exonic
1099790356 12:87326484-87326506 TGATGTTAGATAGCAGTGAATGG + Intergenic
1105387927 13:19949236-19949258 TTTTTGTATGTAGCAGAGATGGG - Intergenic
1105629283 13:22145379-22145401 TTTTGGTATTTAGTAGTGATGGG - Intergenic
1105729935 13:23202431-23202453 ATATGGAAGGTAGAATTGATAGG + Intronic
1107160448 13:37220071-37220093 TAATGTTGAGTAGCAGTGATCGG + Intergenic
1107995770 13:45859624-45859646 TTATTGTTGGTAGTAGTGTTTGG + Intergenic
1112100287 13:96181413-96181435 TTATCGTAGTTAGCAATGACTGG + Intronic
1112312953 13:98335824-98335846 TTCTGATAGGTATCAGTGGTAGG + Intronic
1112745345 13:102521288-102521310 TTATGGAAGGTAGTAATGTTTGG + Intergenic
1118006417 14:61568081-61568103 TGAGGGCAAGTAGCAGTGATGGG - Intronic
1119624405 14:76159739-76159761 TGAGGGTAGGAAGCAGTTATAGG - Intronic
1124076814 15:26454007-26454029 TTAGGGTATATAGCAGTGCTTGG - Intergenic
1124567059 15:30825885-30825907 TTCTGGTAGGTGGAAGAGATGGG + Intergenic
1125777649 15:42232359-42232381 TTATGGCTGGGAGCAGTGGTGGG - Intronic
1126652384 15:50937821-50937843 TTATGGTGGGGAGCAGTGGAAGG + Intronic
1126885817 15:53148540-53148562 CTGTGTTAAGTAGCAGTGATAGG + Intergenic
1130727199 15:86451615-86451637 TTTTGGTAGGTAGCAGCAACTGG - Intronic
1134310982 16:13075065-13075087 TTATGGTAGGGGGCAGATATAGG - Intronic
1135838277 16:25848925-25848947 TTATGGAATGTAGCAGTACTTGG - Intronic
1137616142 16:49848273-49848295 TTATTGTAGGTGACGGTGATAGG + Intronic
1140580924 16:76230240-76230262 TTATGTTTTGTAGGAGTGATGGG + Intergenic
1144609500 17:16697235-16697257 TTATGGTATAAAGCAGGGATTGG + Intronic
1144903272 17:18618316-18618338 TTATGGTATAAAGCAGGGATTGG - Intergenic
1145129300 17:20328436-20328458 TTATGGTATAAAGCAGGGATTGG + Intergenic
1145195359 17:20889199-20889221 TTATGGTATAAAGCAGGGATTGG - Intronic
1145725014 17:27112171-27112193 AAGTGGTAGGTAGGAGTGATGGG - Intergenic
1146397387 17:32479668-32479690 TTATTGTGTGTAGCAGTGAAGGG + Intronic
1147309084 17:39583620-39583642 TCATGGTAGGGAGCATGGATAGG - Intergenic
1153776790 18:8461633-8461655 CTTTGGAAGGGAGCAGTGATTGG + Intergenic
1156056546 18:33011875-33011897 TTACGGTGGGCTGCAGTGATCGG + Intronic
1156060839 18:33074338-33074360 CCTTGGTAGGAAGCAGTGATTGG - Intronic
1158046379 18:53160238-53160260 TAATGAGAGGTTGCAGTGATTGG - Intronic
1158489629 18:57898384-57898406 TTATGATAGGTGGCAGGGAGGGG - Intergenic
1161765104 19:6203172-6203194 TTATGGTAGGTTGGAGTGGAGGG + Intergenic
1164695287 19:30239371-30239393 TGCTGGTAGGTAGCAGTGCTGGG + Intronic
1165048901 19:33128757-33128779 TGATGGTAGGCAGCAGTGAGGGG + Intronic
1165554420 19:36617685-36617707 TTGTGGGAGGGGGCAGTGATGGG + Intronic
1166414024 19:42579168-42579190 TTATGGAAGTTACCAGTGTTAGG + Intergenic
925114996 2:1371177-1371199 TCATGGGCGGTATCAGTGATTGG - Intergenic
927122560 2:19981017-19981039 TTCTGGTAGCTAGCCATGATTGG - Intronic
929495949 2:42444013-42444035 CTATGGTAGATAAAAGTGATAGG + Exonic
931810677 2:65851720-65851742 TTAAGGCAGGTAGCAGTGTTTGG + Intergenic
932138435 2:69253233-69253255 TTTTTGTATGTAGCAGAGATAGG - Intergenic
941164993 2:162074543-162074565 TTATGTTAGGAAGCAGTGAGGGG + Intergenic
941191767 2:162393080-162393102 TTATTGGAGGTAGCAATAATAGG + Intronic
942970497 2:181952435-181952457 TTAAGGAAGGTAGCAGTTGTAGG + Intergenic
945030441 2:205658324-205658346 CTATGCTAAGTAGCACTGATAGG + Intergenic
947297014 2:228642476-228642498 TTACGGGAGGTAGTAGTGAAGGG + Intergenic
948485345 2:238277458-238277480 TCTTGGGAGGTAGCAGTGGTGGG - Intronic
1170644416 20:18184354-18184376 ATAGGGTAGGTAGCAGTGCACGG - Intronic
1173073835 20:39797082-39797104 TTATGGAAGGCCCCAGTGATGGG + Intergenic
1175867062 20:62184521-62184543 TCAGGGAAGGCAGCAGTGATCGG + Intronic
1176416476 21:6478416-6478438 TTCTGGTGGGGTGCAGTGATGGG - Intergenic
1178815774 21:35928050-35928072 TTATTGTAGGAAGACGTGATTGG + Intronic
1179691976 21:43086751-43086773 TTCTGGTGGGGTGCAGTGATGGG - Intergenic
950693398 3:14678736-14678758 TTCTGGCATGTAGCAGTGCTGGG + Intronic
953879558 3:46684591-46684613 TTCTGGTATGGAGCAGTGATTGG - Intronic
954725665 3:52606980-52607002 TGATGTTGGGTAGCAGTGGTGGG + Intronic
955682244 3:61514376-61514398 ATCTGGTAGGTAGCAGAGCTGGG + Intergenic
957939224 3:86983912-86983934 TAATGGTAAGTGGCAGAGATGGG + Intronic
958665205 3:97128355-97128377 TTTGGGTAGGTACCAGTAATGGG + Intronic
959567642 3:107848983-107849005 TTATTGTTGGTAGCAGTAATGGG + Intergenic
962835894 3:139188064-139188086 TAATGGTAGGTGGCAGTGGTTGG - Intronic
962836135 3:139190264-139190286 TAGTGGTAGGTGGCAGTGCTTGG - Intronic
963848464 3:150183245-150183267 TTATGGATGGTCTCAGTGATGGG + Intergenic
964490122 3:157227364-157227386 TTATGGTAGGTTACTGTGTTGGG + Intergenic
966892272 3:184416152-184416174 TTATGGCTGGTTGCAGTGAAGGG + Intronic
967468638 3:189837233-189837255 TTTTGGTAGGCAGCAGTGAGAGG - Intronic
969949088 4:10815374-10815396 TAATGGTAGGTAGCTGGAATAGG - Intergenic
974283157 4:59825459-59825481 TAAAGGTATTTAGCAGTGATTGG + Intergenic
974533025 4:63136466-63136488 GTATGGTAGGTACTATTGATTGG - Intergenic
974861536 4:67527800-67527822 TTATGTTAAATAACAGTGATGGG - Intronic
975508192 4:75162627-75162649 ACAAGGTAGGTAGCAGTGAAAGG + Intergenic
975847395 4:78539221-78539243 TATTGGTAGGTGGCAGTGACTGG - Intronic
976653681 4:87464081-87464103 TTAAGGTAGGGAGCAGAGAAAGG - Intergenic
977042959 4:92037371-92037393 TGATGGTAGCAAGCACTGATAGG + Intergenic
978268653 4:106859888-106859910 TTATGGTATGCAGTAGTGGTGGG - Intergenic
981002924 4:139845135-139845157 TGAGGGTAGGTATCAATGATAGG + Intronic
981199592 4:141965324-141965346 TGATGATAGGTTTCAGTGATAGG + Intergenic
981908458 4:149951044-149951066 TTATGGCAGGGAGCAGGGAGTGG + Intergenic
990282856 5:54270440-54270462 TTATGGTAGGTAGCAGTGATAGG - Intronic
996090590 5:119347681-119347703 TTTTTGCAGGTAGCAGTGAAAGG - Intronic
999072675 5:148763439-148763461 TGATGGTAAGTAGCAGAGCTAGG + Intergenic
1000149006 5:158481471-158481493 TAAGGGAAGGTACCAGTGATGGG - Intergenic
1001223001 5:169919007-169919029 TTATGTTGGATAGAAGTGATGGG + Intronic
1002986953 6:2199509-2199531 TTAGGGGAGGGAGCAGTGAGTGG - Intronic
1004921416 6:20379489-20379511 GTGTGGTTGGGAGCAGTGATTGG + Intergenic
1007198041 6:40079995-40080017 TTATGCTAGTTACCAGTGCTGGG - Intergenic
1008040592 6:46794485-46794507 AGATCATAGGTAGCAGTGATGGG + Intronic
1008826333 6:55698523-55698545 TCATGATATGTAGCAATGATTGG + Intergenic
1017077695 6:150633841-150633863 GTATGGGAGGCAGCAGTGAATGG + Intronic
1017472158 6:154749676-154749698 ATAGGGTAGGGAGGAGTGATTGG + Intronic
1018881931 6:167892591-167892613 TTTTGGTAGATAGCAGAGACAGG + Intronic
1021405220 7:20259594-20259616 ATATGGTAGGTACCAGTTCTGGG - Intergenic
1023177192 7:37446716-37446738 GTATGGTAGGTATCAGGGAGGGG - Intronic
1026489598 7:70851301-70851323 TTATGGTAGACACCAGAGATTGG + Intergenic
1027862157 7:83598203-83598225 TTATGGTAGATGGCACAGATGGG + Intronic
1035496347 7:159330436-159330458 TTATGGTAGGTAGAAGTCAGTGG + Intergenic
1038806216 8:30794528-30794550 TAATGGTAGGTACCAAGGATGGG - Intronic
1043023754 8:75040667-75040689 TTCTTGTAGGTAGCAGAGATGGG + Intergenic
1044806849 8:96017177-96017199 TTATGGTAGGTAGAAGTAGATGG + Intergenic
1046363238 8:113188763-113188785 TTATGGTAAATGGCAGAGATAGG - Intronic
1048771630 8:137901658-137901680 TTCTGGTAGGTAGCAAGAATTGG + Intergenic
1048969798 8:139639061-139639083 CTGTGGCAGGTAGCAGTGAGGGG - Intronic
1050369269 9:4903864-4903886 TTATCGTAGGTACAAGTGCTTGG + Intergenic
1050413111 9:5386723-5386745 TAACAGCAGGTAGCAGTGATGGG - Intronic
1055944991 9:81685815-81685837 TGATGGTAGGTATCAAAGATTGG - Exonic
1056427856 9:86495684-86495706 GTAAGGTAGGGTGCAGTGATGGG - Intergenic
1057717453 9:97505760-97505782 TTAAGGAAGGTAGCATTGACAGG - Intronic
1057719834 9:97523194-97523216 TTATGGGAAGTAGCAGAGACAGG + Intronic
1058014524 9:100015537-100015559 TGAAAGCAGGTAGCAGTGATAGG - Intronic
1061665129 9:132156235-132156257 TTATGGCAGTGAGCAGCGATGGG + Intergenic
1188207144 X:27374234-27374256 TTATGGTAGATTACATTGATTGG - Intergenic
1188662025 X:32772554-32772576 ATCTGGTAGGTAGCAGAGCTAGG + Intronic
1191640673 X:63427761-63427783 TGAAGGTAGGTAGCCATGATAGG + Intergenic
1193806177 X:85997591-85997613 GTAGGGTAGGTAGTAGTGGTGGG - Intronic
1193872690 X:86821141-86821163 TTAGGGTAGGAAGCAGTCAGTGG - Intronic
1194773941 X:97939659-97939681 TCATGGTATTTAGCAGTGTTAGG - Intergenic
1195503629 X:105631726-105631748 TTGTGATAGGCAGGAGTGATAGG + Intronic