ID: 990282857

View in Genome Browser
Species Human (GRCh38)
Location 5:54270453-54270475
Sequence TGGGCATTCTAAGTTATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990282857_990282869 23 Left 990282857 5:54270453-54270475 CCTACCATAACTTAGAATGCCCA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 990282869 5:54270499-54270521 CCTGGTTTCGACACACTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 52
990282857_990282860 -10 Left 990282857 5:54270453-54270475 CCTACCATAACTTAGAATGCCCA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 990282860 5:54270466-54270488 AGAATGCCCACGTATCCCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 86
990282857_990282865 5 Left 990282857 5:54270453-54270475 CCTACCATAACTTAGAATGCCCA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data
990282857_990282861 -9 Left 990282857 5:54270453-54270475 CCTACCATAACTTAGAATGCCCA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 990282861 5:54270467-54270489 GAATGCCCACGTATCCCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282857 Original CRISPR TGGGCATTCTAAGTTATGGT AGG (reversed) Intronic
903844786 1:26272532-26272554 TGGGCATTCCAGGCTATGGAAGG + Intronic
905931890 1:41793945-41793967 TTGGTTTTGTAAGTTATGGTGGG - Intronic
906624424 1:47313509-47313531 AGGGCATTCCAAGTTAAGGGAGG - Intronic
909078743 1:71083874-71083896 TGGGCTTTCTATGTCTTGGTTGG + Intergenic
909401285 1:75233981-75234003 TTGGAATTATAGGTTATGGTAGG - Exonic
917585769 1:176425380-176425402 TGGGTATTCTCAGTTGTGGGTGG + Intergenic
918222075 1:182444344-182444366 TGGGCATTCTGAGTTATTGTGGG + Intergenic
919749351 1:201026852-201026874 TGGGCATTGGAAGATATGGCTGG - Intergenic
921712956 1:218391158-218391180 TGGGCATTCTGGGCTAAGGTGGG + Intronic
922897721 1:229113435-229113457 TGGGCATTCTGAGACATGCTGGG - Intergenic
1064305691 10:14164120-14164142 TGGGCTTTCAAAGCCATGGTTGG - Intronic
1064460651 10:15532021-15532043 TCAGCATTCTGAGTTAGGGTGGG + Intronic
1074130697 10:110571392-110571414 TGACCTTTCTAAGGTATGGTGGG - Intronic
1079670766 11:23168037-23168059 TGGGAATTCTGAGATGTGGTAGG - Intergenic
1081832452 11:46125017-46125039 TTGGCATTATAAGCTTTGGTGGG + Intergenic
1083111784 11:60417150-60417172 TTGACATTCTAGGTTATGTTGGG - Exonic
1084758734 11:71254874-71254896 TTGGCATTCTAATTTCTGGGGGG + Intergenic
1087366536 11:97226755-97226777 TGGGTATACTGAGTAATGGTAGG + Intergenic
1090605483 11:128419261-128419283 TGGGCTTTCTGGGTAATGGTGGG + Intergenic
1090946995 11:131439434-131439456 TGGTCTTTCTGAGCTATGGTGGG + Intronic
1092342635 12:7689727-7689749 TGGGCATTGTTAATTATGGTGGG + Intergenic
1096977378 12:55707360-55707382 TGGGCAGTCTAGGTCTTGGTGGG + Intronic
1096992238 12:55814311-55814333 AGGGCTTTCTAAGTTATGTAAGG - Intronic
1111882606 13:93976696-93976718 TGGGCCATCTCAGTTCTGGTAGG + Intronic
1114853833 14:26413597-26413619 TGGGCATTCTATGATATTGGTGG - Intergenic
1117678605 14:58180627-58180649 TGGGCATTCTTATTTATTATTGG + Intronic
1124589350 15:31039788-31039810 TGTGCATACTGAGTTATGGGGGG + Intronic
1127524181 15:59775624-59775646 TGGGCGCTCTAAGTTATCCTGGG - Intergenic
1132082967 15:98883314-98883336 TGGTCATCCTAAGGAATGGTTGG - Intronic
1133449664 16:5893199-5893221 TGGGCATTCAAAGCTATGTGAGG - Intergenic
1138013500 16:53407330-53407352 TGGACATTTTGAGTTTTGGTGGG + Intergenic
1148660584 17:49328388-49328410 TCAGCATTCCAAGTTATTGTAGG - Intronic
1151014810 17:70542103-70542125 TAGGCATTCTAAATGATGGATGG + Intergenic
1151108193 17:71643235-71643257 TGGTCACTCTAACTTCTGGTAGG + Intergenic
1159533303 18:69683368-69683390 TTCACATTCTAAGTTATGGAGGG - Intronic
1162642327 19:12021400-12021422 TGGAAATACTAAGTTTTGGTGGG - Intronic
1165466115 19:35975897-35975919 TGGACTTTCTAAGTAATGGCAGG - Intergenic
1167067746 19:47199600-47199622 TGGGCATTCAAAGTGATGAACGG - Intronic
929250110 2:39743899-39743921 TGCCCATTCTATGTTATGGAAGG + Intronic
930540035 2:52693919-52693941 TTGGCAAGCTAAGTTATTGTAGG - Intergenic
930594422 2:53368923-53368945 TGAACATTTTAAGTTGTGGTAGG - Intergenic
932795255 2:74689383-74689405 TGGGCATTCTATACTATTGTTGG + Intergenic
932840397 2:75076824-75076846 TGAGAACTCTAAGTTTTGGTAGG + Intronic
936098978 2:109558657-109558679 TGGGTATGCTGAGTCATGGTGGG - Intronic
938102485 2:128506647-128506669 TGGGCATTCTATAGTATGTTAGG + Intergenic
938730865 2:134146072-134146094 TGGGCATTCTTAGTTAAGTGTGG + Intronic
941588322 2:167387139-167387161 AGGGCATTAAAAGATATGGTAGG + Intergenic
946627167 2:221625474-221625496 ATGGCATTTTAAGTTATAGTAGG - Intergenic
947946338 2:234106121-234106143 AGAGCTTTCTAAGGTATGGTAGG - Intergenic
1170039303 20:12023442-12023464 TGGTCATTCTAAGCTCTGGTTGG - Intergenic
1171044039 20:21793810-21793832 TTGGACTTCTAATTTATGGTTGG - Intergenic
1174285097 20:49467137-49467159 TGGTCCTTCTAAGTTTAGGTGGG - Intronic
1176115876 20:63431806-63431828 TGGGAATTCTAAGCTGGGGTGGG - Intronic
1177085535 21:16698198-16698220 TGGGCATTCTAATCTTTGATGGG + Intergenic
950972057 3:17198906-17198928 AGGCCATTCTAACGTATGGTCGG + Intronic
951084728 3:18498186-18498208 TGGGCATTCTAAGGTTAGGTTGG + Intergenic
951395954 3:22166719-22166741 TGGCTATTCTAAATTATGCTTGG + Intronic
953251574 3:41249288-41249310 TGGGAATCCCCAGTTATGGTGGG - Intronic
963307820 3:143673531-143673553 TTGGCTTTATAATTTATGGTTGG + Intronic
963622628 3:147631314-147631336 TGGGCATTCTAAATTTAGTTTGG + Intergenic
964978040 3:162643272-162643294 TGGGGATTATAATTTATGTTTGG + Intergenic
965608947 3:170525077-170525099 TGGGAATTCTAACTTATATTGGG - Intronic
966739911 3:183223002-183223024 TGGGCATTTTAACTTGTGGAAGG - Intronic
967576179 3:191096405-191096427 TTGGCATTCTAGGTAATTGTAGG + Intergenic
969328674 4:6460045-6460067 TGGGTATCAGAAGTTATGGTTGG - Intronic
976618350 4:87101204-87101226 CGTGCATTCTAAGAGATGGTGGG - Intronic
979839273 4:125417580-125417602 GGAGGATTCTAAGTTATGGAGGG + Intronic
979985449 4:127308264-127308286 TGTGCCTGCTATGTTATGGTCGG + Intergenic
983409412 4:167377954-167377976 TGCACATTCTAAGATATTGTAGG + Intergenic
990282857 5:54270453-54270475 TGGGCATTCTAAGTTATGGTAGG - Intronic
998588909 5:143456714-143456736 TGGGCCTTTTAGGTCATGGTAGG - Intergenic
1000265387 5:159631435-159631457 TGGCCATTCTAATTTTTGTTAGG + Intergenic
1000332261 5:160215211-160215233 TGGCCATTAAAAGTGATGGTGGG + Intronic
1002703508 5:181144044-181144066 TGAGAATTCCAAATTATGGTTGG + Intergenic
1008500879 6:52181701-52181723 TGGTCATTCTAACTCTTGGTAGG - Intergenic
1009946515 6:70347368-70347390 TGGGCATCCTTAGCTGTGGTTGG + Intergenic
1010495800 6:76532854-76532876 TAGGTATTCTCAGTTGTGGTTGG + Intergenic
1018441543 6:163818308-163818330 TGAGCATTCTCAGTGCTGGTGGG - Intergenic
1019217418 6:170452646-170452668 TGGGCATTCTCAGTGAGAGTGGG - Intergenic
1027516842 7:79152758-79152780 TGGGTATTCAAAGTTAAGGATGG - Intronic
1030138173 7:106279167-106279189 AAGGCATTCTAAGTAAAGGTAGG - Intronic
1031313579 7:120230251-120230273 TGGGCATGCTAAGGTAGGGCAGG + Intergenic
1032896682 7:136259074-136259096 TAGGCATTTTAAGTTATCTTAGG + Intergenic
1033197953 7:139343152-139343174 TGGGAATTCTAGGTTAATGTAGG - Intronic
1050096057 9:2067806-2067828 TGGGGATTTTAAGTAATGGAAGG + Intronic
1051405606 9:16734819-16734841 TAGGCCTTCTAACTTAAGGTTGG + Intronic
1059770313 9:117417450-117417472 TGGGCATTCTAGGTTAAAGTTGG + Intergenic
1198777688 X:140198285-140198307 TGGGCTTTCTAAGTGAATGTTGG - Intergenic
1200337677 X:155367168-155367190 TGGGCATTTGAATTTATGTTAGG + Intergenic
1200348793 X:155474059-155474081 TGGGCATTTGAATTTATGTTAGG - Intergenic
1201345286 Y:12976773-12976795 TGGGGATTCCAAGGTATGGGTGG - Intergenic
1201565256 Y:15358687-15358709 AGGCCATTCTAAATTAAGGTTGG + Intergenic