ID: 990282858

View in Genome Browser
Species Human (GRCh38)
Location 5:54270457-54270479
Sequence TACGTGGGCATTCTAAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990282858_990282869 19 Left 990282858 5:54270457-54270479 CCATAACTTAGAATGCCCACGTA 0: 1
1: 0
2: 1
3: 5
4: 38
Right 990282869 5:54270499-54270521 CCTGGTTTCGACACACTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 52
990282858_990282865 1 Left 990282858 5:54270457-54270479 CCATAACTTAGAATGCCCACGTA 0: 1
1: 0
2: 1
3: 5
4: 38
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282858 Original CRISPR TACGTGGGCATTCTAAGTTA TGG (reversed) Intronic
901132216 1:6969130-6969152 TCCGTGGGCATTTTCAGTGAGGG + Intronic
906624426 1:47313513-47313535 TACTAGGGCATTCCAAGTTAAGG - Intronic
908146709 1:61253748-61253770 GACGTGGTCATTCTAACATAAGG - Intronic
908682227 1:66675002-66675024 TACATAGGGATTCTAAGTTATGG - Intronic
918578964 1:186101974-186101996 TACTTGGGCATTCTCAGTTGCGG + Intronic
1066194238 10:33083337-33083359 TAAGTGGGAATTCTATGTAATGG + Intergenic
1068537800 10:58259509-58259531 TTAGTTGGCATTCTATGTTAAGG - Intronic
1074890384 10:117731021-117731043 TACGTGAGCCTTGTAAATTATGG - Intergenic
1082650998 11:55793506-55793528 GACGTGAGCATTCTGAGTTGAGG - Intergenic
1085936148 11:81146587-81146609 TACATAGAAATTCTAAGTTAAGG + Intergenic
1095724432 12:45436193-45436215 GAAGTGGGCATTCTATGTTATGG - Intronic
1111868822 13:93804556-93804578 TAAGTGGGAACACTAAGTTATGG - Intronic
1113212357 13:107999220-107999242 TGCCTGGGCATTGGAAGTTAGGG + Intergenic
1116928395 14:50665763-50665785 TACTTGGGCATTTTAAATTGAGG + Intronic
1124589346 15:31039784-31039806 TGCGTGTGCATACTGAGTTATGG + Intronic
1130860285 15:87879903-87879925 TATGTGGGCATACTAAGTAGTGG + Intronic
1143686272 17:8518462-8518484 TACATGAACATTCTAAGTAATGG - Intronic
1143768716 17:9154206-9154228 TACCTGGGCATGCTAAGGTCTGG - Intronic
1149155134 17:53619890-53619912 TACGTGGTCATTCTCAGTCTGGG - Intergenic
1168673264 19:58257622-58257644 TACGTGGGCATGGAAATTTAGGG + Intronic
932363252 2:71128315-71128337 TACATGGTAATTCTATGTTATGG - Intronic
935832769 2:107017691-107017713 TACATGAGCATTATAAGTCATGG - Intergenic
960001781 3:112739918-112739940 TACCTGGCCCTTCTAAGTCAGGG - Intergenic
962118942 3:132541740-132541762 TTAGTGGGCATTCCAAGTTTTGG - Intergenic
962146216 3:132842717-132842739 AACATGGACATTCTAATTTATGG + Intergenic
987211744 5:15690955-15690977 GATGTTGGCACTCTAAGTTAAGG + Intronic
989435487 5:41408468-41408490 TATGAGGACATTCTAAGTTTTGG + Intronic
990282858 5:54270457-54270479 TACGTGGGCATTCTAAGTTATGG - Intronic
993976146 5:94483790-94483812 TACGTGGGCAAAGTAAGTAAAGG + Intronic
996638440 5:125723737-125723759 GACATGGGCATTCTAAGTTATGG - Intergenic
998790044 5:145756317-145756339 TATGTGTGCATTCTAATTTTGGG - Intronic
1002471180 5:179437176-179437198 TACATGGGCATTTAAAGTTCAGG + Intergenic
1016986959 6:149902419-149902441 TACCTAGTCATTCTAGGTTAAGG + Intergenic
1018236728 6:161733371-161733393 TACAGGAGGATTCTAAGTTAAGG - Intronic
1027516843 7:79152762-79152784 GATGTGGGTATTCAAAGTTAAGG - Intronic
1037532494 8:19791270-19791292 TACTTGGGCATGGAAAGTTAGGG - Intergenic
1040870525 8:52096323-52096345 AAGATGGGCATTCTAAGTGAAGG - Intergenic
1043934122 8:86123647-86123669 TTCCTGGGAATTCTAAGTTAAGG + Intronic
1046010543 8:108541294-108541316 TACCTGGCAATTCTAAGTTTAGG - Intergenic
1056279008 9:85021417-85021439 TACCTGGACATTCTAGGCTAGGG + Exonic
1056456889 9:86768804-86768826 TAGGTGGGGAATCTAAGCTATGG - Intergenic
1186072457 X:5837094-5837116 CACGTGGTCATTCTATGTTTAGG + Intergenic
1189178078 X:38978188-38978210 TAAGTGGGCAATCTGAGATATGG + Intergenic
1200387680 X:155909370-155909392 TACTTGGTCATTCTACGTAAAGG + Intronic
1201565255 Y:15358683-15358705 TATGAGGCCATTCTAAATTAAGG + Intergenic