ID: 990282865

View in Genome Browser
Species Human (GRCh38)
Location 5:54270481-54270503
Sequence CCCCAGGGGCATGTGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990282857_990282865 5 Left 990282857 5:54270453-54270475 CCTACCATAACTTAGAATGCCCA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data
990282858_990282865 1 Left 990282858 5:54270457-54270479 CCATAACTTAGAATGCCCACGTA 0: 1
1: 0
2: 1
3: 5
4: 38
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data
990282856_990282865 18 Left 990282856 5:54270440-54270462 CCTATCACTGCTACCTACCATAA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990282865 Original CRISPR CCCCAGGGGCATGTGTATCC TGG Intronic
No off target data available for this crispr