ID: 990283950

View in Genome Browser
Species Human (GRCh38)
Location 5:54280949-54280971
Sequence TTGGGTCAACTGACACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990283945_990283950 4 Left 990283945 5:54280922-54280944 CCAAGTTAAGAAATGAGCTCAAG 0: 1
1: 0
2: 1
3: 19
4: 228
Right 990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 95
990283944_990283950 5 Left 990283944 5:54280921-54280943 CCCAAGTTAAGAAATGAGCTCAA 0: 1
1: 0
2: 1
3: 21
4: 297
Right 990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 95
990283943_990283950 12 Left 990283943 5:54280914-54280936 CCAAAATCCCAAGTTAAGAAATG 0: 1
1: 0
2: 4
3: 31
4: 293
Right 990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990283950 Original CRISPR TTGGGTCAACTGACACAGGC TGG Intronic
901207916 1:7507907-7507929 TTCGGTCAACAGACACACGCTGG - Intronic
905321537 1:37120681-37120703 TTGGGTGAAATGGCCCAGGCAGG - Intergenic
917833414 1:178918139-178918161 TGGGGTTTAGTGACACAGGCTGG + Exonic
919257961 1:195150568-195150590 TAGGGACAACTCACCCAGGCTGG + Intergenic
1068728175 10:60326354-60326376 TTGAGTCAAATGACACATGGAGG - Intronic
1068901125 10:62269744-62269766 TTGGGACAACAGACCCAGACAGG - Intergenic
1072411534 10:95207036-95207058 TGGGGAAAACTGAGACAGGCAGG - Intronic
1073199194 10:101721044-101721066 ATGGACCTACTGACACAGGCAGG - Intergenic
1076451377 10:130559380-130559402 TTGGGTCAAATGAGTCAGGCCGG + Intergenic
1077347970 11:2073093-2073115 TGGGGTCAACTGACCCTGGCCGG - Intergenic
1077481737 11:2818204-2818226 TTGGGTCACCTGACACTGAGGGG - Intronic
1078129744 11:8603573-8603595 TTGGGTCAACTGACAAAATGGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1084176111 11:67423189-67423211 GTGGGACACCTGATACAGGCCGG - Intronic
1086367619 11:86123722-86123744 TTGGCATAACTGAGACAGGCTGG + Intergenic
1086885122 11:92196996-92197018 AGTGGTCAAGTGACACAGGCTGG + Intergenic
1088739764 11:112757580-112757602 GTGGCTCCACTGACTCAGGCTGG + Intergenic
1090322316 11:125857879-125857901 TGGAGTCTACAGACACAGGCAGG - Intergenic
1091777849 12:3196259-3196281 TTGAGTTACCTGACACAGGCTGG - Intronic
1092070590 12:5628269-5628291 GTGGGTCAGATGACCCAGGCAGG - Intronic
1092714785 12:11377695-11377717 TGGGGTCTACAGAGACAGGCAGG - Intronic
1093699608 12:22203957-22203979 CTGGGTAATCTGACACAGGTGGG + Intronic
1094270664 12:28610907-28610929 TTGGGTGGTCTGACATAGGCTGG + Intergenic
1100684911 12:96977161-96977183 ATGGGACAACCGACACAGGGAGG - Intergenic
1100784268 12:98062723-98062745 TTGGGAGCACTGACACAGGCTGG - Intergenic
1101810523 12:108103843-108103865 TGGGGTCACCTGATCCAGGCTGG - Intergenic
1111156824 13:84338350-84338372 CTAGGTCCACGGACACAGGCTGG + Intergenic
1113575274 13:111390766-111390788 TTGGGTCATCTGAAACGGGGTGG + Intergenic
1114411608 14:22506035-22506057 TCAGGGCAACTGACACAGCCAGG + Intergenic
1117140242 14:52783449-52783471 TTGGGTCAGCTAACAGAGACTGG - Exonic
1121690610 14:95875560-95875582 TTGGGACCTCTGACACAGACTGG - Intergenic
1126494736 15:49277938-49277960 TTGGGTCTACTTACAGGGGCAGG - Intronic
1127100025 15:55554522-55554544 TTGGCTGAACTGACAGAGGTAGG + Intronic
1127544247 15:59975575-59975597 ATGGGACAACTGACAAAGTCTGG + Intergenic
1127920917 15:63493503-63493525 ATGGGTCAACTTCCCCAGGCTGG + Intergenic
1128151585 15:65366654-65366676 CTGGCTCACCTGACTCAGGCAGG - Intronic
1128253404 15:66179639-66179661 TTGGGGAAACTGAGACAGGGAGG - Intronic
1129780378 15:78265904-78265926 TTGGAACAACTAACACAGACAGG - Intronic
1132933405 16:2469822-2469844 CTGGAGCAACTGACACTGGCTGG - Intergenic
1141948579 16:87326207-87326229 CTGTGACAACTGTCACAGGCCGG - Intronic
1142093813 16:88228801-88228823 TTATGACATCTGACACAGGCAGG - Intergenic
1142469202 17:153284-153306 TCTGGTCAACTTCCACAGGCAGG - Intronic
1146669078 17:34724433-34724455 CTGTGTCAACTGTCAGAGGCAGG + Intergenic
1148228173 17:45913947-45913969 CTGGATCAACTGGAACAGGCAGG + Intronic
1150294734 17:64001682-64001704 TGGGGTCCACTGAGACAGGAGGG + Intronic
1151323424 17:73364979-73365001 TTTGGTCAACGGAAACAGGGAGG - Intronic
1163485916 19:17585842-17585864 TTGGGTAAATTGAGACAGGTGGG + Intergenic
1167361309 19:49031955-49031977 TTGGGTCCGCTGACTCCGGCCGG + Intronic
1167627920 19:50604773-50604795 TTGGGTCCGCTGACTCCGGCCGG - Intergenic
926010884 2:9407029-9407051 TGGGTTCCACTGACCCAGGCAGG - Intronic
926251345 2:11156898-11156920 TTGTGGCAAAGGACACAGGCTGG + Intronic
926420740 2:12694558-12694580 TTGGGTCAACTCACCATGGCTGG - Intergenic
927124776 2:20004095-20004117 TTGGGTTACCTGCCACAGGAGGG - Intronic
928839021 2:35583325-35583347 TCGGGAGAACTGACAAAGGCAGG - Intergenic
929724735 2:44413281-44413303 TAGGGTCAAATGAAAGAGGCAGG + Intronic
934752288 2:96800791-96800813 ATGGGTCAACGGACAGAGCCTGG - Intronic
935712410 2:105910907-105910929 TTGGGTCTAATGATAGAGGCAGG + Intergenic
935715792 2:105937898-105937920 TTGTTTCAATGGACACAGGCAGG + Intergenic
941740949 2:169034615-169034637 TTGTGTTAACTGACTCATGCTGG - Intergenic
942308638 2:174633418-174633440 TTGTGTTAACTGAGACAGGGAGG - Intronic
946774398 2:223122779-223122801 TTGGTTGAACTGTCACAGGAAGG + Intronic
1180137958 21:45873373-45873395 TTGGGTCAACTGACACTGTGAGG - Intronic
1184313875 22:43667300-43667322 CAGTGTCAACTGACACACGCAGG + Intronic
1185411934 22:50687243-50687265 ATGGTTCAACTGACACAGCCTGG - Intergenic
950676255 3:14556046-14556068 TTGCGCTAACTGGCACAGGCTGG + Intergenic
951134620 3:19090235-19090257 GTAGGTCAGCTGACTCAGGCTGG + Intergenic
952959249 3:38579465-38579487 CTGGGCCACCGGACACAGGCTGG + Exonic
954785484 3:53089485-53089507 TTGGGTAAAGTGAGGCAGGCTGG + Exonic
957285167 3:78208359-78208381 TAGGGGCAAATGACACAGTCAGG + Intergenic
960596663 3:119413742-119413764 TTTGCTGAACTGGCACAGGCTGG + Intronic
960904390 3:122585188-122585210 TTGAGTCAGCTGACACAGACAGG + Intronic
960933983 3:122884682-122884704 TTAGGTTAAATGACACAGCCAGG + Intergenic
965449695 3:168822454-168822476 TTGGGGCCACTTACAGAGGCAGG + Intergenic
967856648 3:194122912-194122934 CTGGGACAACTGGCATAGGCTGG - Intergenic
968933651 4:3597764-3597786 CTGGGTTAGTTGACACAGGCCGG + Intergenic
969090794 4:4692557-4692579 ATGGGTGAACTGAGAAAGGCAGG - Intergenic
975785254 4:77880832-77880854 ATGGGTCAGCTGACATAGGCTGG + Intronic
976206160 4:82625411-82625433 TTGGCTCCACTGTCCCAGGCTGG + Intergenic
976206579 4:82628282-82628304 TTGGCTCCACTGTCCCAGGCTGG + Intergenic
980217962 4:129876339-129876361 TGGAGTCAACTGAGGCAGGCAGG + Intergenic
984710974 4:182884710-182884732 TTGGGTCAACTGACAAAATTGGG + Intergenic
990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG + Intronic
994027548 5:95102297-95102319 TTGGGTCAGCTGAGACTGGCTGG - Intronic
998602916 5:143603568-143603590 TTGAGTCAACAGTCACATGCAGG + Intergenic
999153535 5:149442260-149442282 TTGGGGCAACTGGGTCAGGCTGG - Intergenic
999471272 5:151857325-151857347 TTGCCTCAAGTGACACAGTCAGG + Intronic
1003321390 6:5055176-5055198 TTGGGTCAACCCAGAAAGGCAGG - Intergenic
1005997000 6:30937491-30937513 TTGGGGCCACTGAAAGAGGCGGG + Intergenic
1007176579 6:39901689-39901711 TGGGGCCAACAGATACAGGCAGG + Intronic
1007595760 6:43050347-43050369 TTGGGTGCACTGGCACATGCTGG - Exonic
1015496203 6:133886042-133886064 TTTGGTCAGGAGACACAGGCTGG - Intergenic
1015965310 6:138692114-138692136 GTGGGAAAACTGTCACAGGCAGG - Intronic
1019561030 7:1657458-1657480 GTGGGTGAATTAACACAGGCAGG + Intergenic
1024296440 7:47846721-47846743 ATGAGAGAACTGACACAGGCTGG + Intronic
1028403071 7:90445881-90445903 TTGAGTGGAGTGACACAGGCAGG - Intronic
1031066745 7:117113842-117113864 TTGGGATGAATGACACAGGCTGG + Intronic
1034344492 7:150378329-150378351 CTGGGTCAACTCCCACTGGCAGG - Intronic
1035323749 7:158051467-158051489 TTGGTGCACCTGACACAGGGAGG - Intronic
1037710939 8:21355047-21355069 TTTAGGCAACTGACACAGGTGGG + Intergenic
1040457097 8:47609754-47609776 ATGGGTCAAATGATACAGGTTGG - Intronic
1050173940 9:2850847-2850869 TTTGGTCAACTGAGACATGGAGG - Intergenic
1060683994 9:125591368-125591390 TTCAGTCAACTGACAGTGGCAGG - Intronic
1062417996 9:136463137-136463159 TTGGGTCAACAGGAACAGGAAGG + Intronic
1194912499 X:99664110-99664132 TTGGTTCAGCTGACACGGGATGG + Intergenic
1195658520 X:107356158-107356180 TAGGTTCCACTGATACAGGCTGG + Intergenic
1197732859 X:129826818-129826840 TTAGCTCAACTAAAACAGGCTGG + Intronic