ID: 990285008

View in Genome Browser
Species Human (GRCh38)
Location 5:54292409-54292431
Sequence GTGGAGGGCAGGAGTTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990285008_990285012 -6 Left 990285008 5:54292409-54292431 CCACTGAAACTCCTGCCCTCCAC 0: 1
1: 0
2: 3
3: 35
4: 317
Right 990285012 5:54292426-54292448 CTCCACCTGTTATCAGCAAGCGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990285008 Original CRISPR GTGGAGGGCAGGAGTTTCAG TGG (reversed) Intronic
900638440 1:3676711-3676733 GTGGAGGCCAGGAGGCCCAGTGG - Intronic
901910350 1:12452474-12452496 GTGGAGGGAGGGAATTCCAGTGG - Intronic
903844753 1:26272289-26272311 GGGGAGTGCAGGAGAGTCAGTGG + Intronic
904420741 1:30389645-30389667 GTGGAGGGCAGTGGTGTCTGGGG - Intergenic
905190174 1:36227598-36227620 GAGGAAGGAAGGGGTTTCAGGGG + Intronic
905974896 1:42167820-42167842 GTGAGGGGCAGGAGTTTCGGAGG + Intergenic
907176056 1:52523516-52523538 GTGGGAGGCAGAAGTTGCAGTGG + Intronic
907378603 1:54065860-54065882 GTTGAGGCCAGGAGTTTGACTGG + Intronic
907834427 1:58095553-58095575 CTGGAGGGCTGGAGTTACATCGG + Intronic
912137615 1:106680934-106680956 TTGGTGGGCAGAAGTTTGAGGGG - Intergenic
916119105 1:161512196-161512218 GTGGGAGGCAGGAGTCTAAGGGG + Intronic
916128864 1:161593855-161593877 GTGGGAGGCAGGAGTCTAAGGGG + Intronic
916138780 1:161675686-161675708 GTGGGAGGCAGGAGTCTAAGGGG + Intronic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917406372 1:174711675-174711697 GTGGAGGGCAGGAGTGCCAGGGG - Intronic
919924850 1:202186917-202186939 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
920934522 1:210418634-210418656 GTAGAAGGCAGGAGTTGCTGGGG + Intronic
921318419 1:213914298-213914320 GAGGAAGGCAGGAGCTTCAGAGG + Intergenic
922006237 1:221533411-221533433 GTGAAGGGCAGAAGTTTCACGGG - Intergenic
922414702 1:225410519-225410541 GTGGCGGGTAGGAGTTACGGTGG - Intronic
922893187 1:229077363-229077385 TTGGAGGCCCTGAGTTTCAGTGG - Intergenic
923963555 1:239109758-239109780 GTGAATTGTAGGAGTTTCAGAGG + Intergenic
1062842816 10:684404-684426 GAGGAGGGTAGGAGGGTCAGTGG - Intronic
1062861759 10:815847-815869 GTCGAGCGCAGGAATTGCAGCGG - Intronic
1063422070 10:5920905-5920927 GTGCAGGGCAGTAGTTTTAAAGG + Intronic
1064418333 10:15168961-15168983 CTGGAGGGGAGGGGTCTCAGAGG - Intergenic
1064619468 10:17201152-17201174 GGGGAGGGAGGGAGTGTCAGGGG - Intronic
1065569446 10:27054961-27054983 GTGGAGAGAATGAATTTCAGGGG + Intronic
1069561195 10:69431004-69431026 CTCGAGGTCAGGAGTTTGAGAGG - Intergenic
1069851571 10:71408775-71408797 GTGGAGGGCCTGGGTGTCAGGGG + Intronic
1070278841 10:75034026-75034048 GTGGAGGGCAGGGTGTTCTGAGG - Intergenic
1070537312 10:77389414-77389436 GAGGAGGGATGGACTTTCAGGGG + Intronic
1070564241 10:77591337-77591359 GAGTAGGGTAGGATTTTCAGAGG - Intronic
1071115196 10:82210469-82210491 GTGGAGGGCAGGGGGTTGAATGG + Intronic
1071825590 10:89322547-89322569 GGGGTGGGCAGGGGTTTCAGGGG - Intronic
1072482639 10:95824371-95824393 GTGGATGGCAAAAGTTTCAGAGG - Intronic
1073290379 10:102410517-102410539 GTGGAAGGCGGGAGTTGCGGGGG - Intronic
1073499492 10:103922948-103922970 CTGGAGGGCAGTAGTTAAAGGGG - Intergenic
1074887610 10:117706476-117706498 ATGGAGGGCAGGAGTCTGTGAGG - Intergenic
1076036148 10:127200033-127200055 TGGGAGGGCAGGCGTTTCATCGG - Intronic
1076995633 11:296297-296319 GTGCCGGGCAGGAGTCTCACAGG + Intergenic
1077482455 11:2822230-2822252 CTGGAGGTCAGGAGTCTCACCGG - Intronic
1077499684 11:2903534-2903556 ATGGAGGGCAGGAGGAACAGCGG - Exonic
1077638701 11:3861853-3861875 GTGGAGGGGAGTAGTTTCCTAGG + Intronic
1077808167 11:5610240-5610262 GTAGAGGTAAGGAGATTCAGGGG + Exonic
1080820685 11:35803338-35803360 GTGACTGGCAGGTGTTTCAGAGG + Intronic
1081244090 11:40742887-40742909 GTGACAGGCAGGAGTTTCTGGGG - Intronic
1081653221 11:44839571-44839593 GGGGAGGGCAGGAGAGACAGAGG - Intronic
1081869829 11:46378268-46378290 GTTGGGGGCAGGAGGCTCAGTGG + Intronic
1082013508 11:47467206-47467228 GTGGAGGGAAGAGGTTACAGGGG - Intronic
1083825894 11:65203897-65203919 ATGGAGGGCAGGGGATGCAGTGG + Intronic
1084599580 11:70136899-70136921 GTGTAGGGCGTGAGTTCCAGTGG + Intronic
1085084885 11:73660548-73660570 ATGTAGGGCAGAAGTTTTAGAGG + Intronic
1086101254 11:83102254-83102276 GTGGAGTGCAGAAGTTGTAGAGG - Intergenic
1086423830 11:86664683-86664705 GTGGAGGGTGGGAGTTCCAGTGG + Intronic
1087847941 11:102994412-102994434 ATGGAAGCCAGGAGTTTCAGAGG + Intergenic
1089814019 11:121156558-121156580 CCGGAGGTCAGGAGTTTGAGAGG - Intronic
1090333991 11:125950810-125950832 CTGGAGGCCAGGGGTGTCAGTGG - Intergenic
1091409886 12:232412-232434 GTGGCGAGCAGGAGTTGTAGGGG - Intronic
1092609202 12:10153948-10153970 CTGGAGGGCAGGAGGTCCTGCGG + Intergenic
1093507436 12:19884846-19884868 GGGTAGGGCAGGTGTTTCTGAGG + Intergenic
1095424445 12:42060473-42060495 GTGGAGGGCAGGTGTGGGAGTGG - Intergenic
1095436611 12:42195894-42195916 GTGGAAGGCAGGAGTTGCGGGGG + Intronic
1096193808 12:49636075-49636097 CGGGAGGGCAGGAGGTACAGGGG - Intronic
1096225924 12:49867010-49867032 GTGGACAGCAGGAGTGTCGGGGG + Exonic
1096875760 12:54629205-54629227 GAGAAGGACATGAGTTTCAGAGG + Intergenic
1097309356 12:58101732-58101754 ATGGAGGGCTGGAGATTCTGAGG + Intergenic
1098893433 12:76031858-76031880 GTAGAGGAGAGGAGTTTCCGGGG - Exonic
1098917141 12:76269288-76269310 GGAGAGGACAGTAGTTTCAGAGG - Intergenic
1099218015 12:79877147-79877169 GTGGAGGGAAGAAGTGTGAGGGG + Intronic
1099830778 12:87839647-87839669 GTGGAGGGTAGGTGTTTTGGTGG + Intergenic
1100028168 12:90153779-90153801 GTGGAGGGGATGTGTTTCACTGG - Intergenic
1101874418 12:108589263-108589285 GTGGAGGGGAGGGGCTGCAGGGG + Intergenic
1101898489 12:108773199-108773221 GATGAGGGCAAGAATTTCAGAGG + Intergenic
1102347112 12:112167411-112167433 AAGGAGGGCAGGAGGTCCAGGGG + Exonic
1102555010 12:113720968-113720990 GGGAAGGGCAGGCTTTTCAGTGG + Intergenic
1103053699 12:117802270-117802292 GAGGAAGGCAGGAGGGTCAGAGG - Intronic
1103899659 12:124296620-124296642 GTGGGGAGGAGGATTTTCAGCGG - Intronic
1103917240 12:124382183-124382205 GTGGAGGTCACCAGGTTCAGCGG + Intronic
1103995563 12:124827783-124827805 CGGGAGGTCAGGAGTTTTAGGGG - Intronic
1106128746 13:26922211-26922233 TTGGAGGGAAGGATTTTCAGGGG + Intergenic
1106197143 13:27503556-27503578 GGGGAGGCCAGGAGTTTGAAGGG + Intergenic
1107405293 13:40106625-40106647 GAACAGGGAAGGAGTTTCAGAGG + Intergenic
1108223773 13:48266318-48266340 GTGGAGGGCAGGGGGTAGAGTGG - Exonic
1108227754 13:48306186-48306208 CTTGAGGCCAGGAGTTTGAGAGG + Intronic
1110731935 13:78888656-78888678 GTGGAGGGCAGGACATACAAAGG + Intergenic
1112184217 13:97112593-97112615 GTGGAAGGCTGGAGTGGCAGAGG + Intergenic
1112562253 13:100525449-100525471 GTGGTGGACAGGAGCTTAAGGGG - Intronic
1113335318 13:109371214-109371236 GAGGAGTGCAGGGGTTTCAGCGG - Intergenic
1113491931 13:110699080-110699102 GTGGAGGGCAAGAGGTCAAGGGG - Intronic
1113853769 13:113432981-113433003 GTGGAGGGCAGGCCTCTGAGAGG - Intronic
1115507175 14:34103829-34103851 GTAGAGGGCAGGAACATCAGTGG - Intronic
1115772633 14:36682312-36682334 GTGGAGGGCAGGTCTGTGAGTGG + Intronic
1116853395 14:49930584-49930606 CTTGAGGTCAGGAGTTTGAGTGG - Intergenic
1119759344 14:77140178-77140200 GTCGGGGGCAGGAGAATCAGCGG + Intronic
1120872086 14:89346990-89347012 GTGGGGGGCAGGGGTGTCAAAGG - Intronic
1121179475 14:91917988-91918010 TTGGGGGGCAGGGGCTTCAGAGG - Intronic
1121452940 14:94020974-94020996 GGGGAGGGGAGGCGTCTCAGAGG - Intergenic
1121916049 14:97837714-97837736 GTGGGGGGCAGCAGTTTGAGAGG - Intergenic
1122585741 14:102805222-102805244 TTGGAGGCCAGGAGATTCACTGG + Intronic
1122894305 14:104748499-104748521 ATGGAAGGCAGGCGTTTCACAGG + Intergenic
1123016341 14:105377353-105377375 GGGGAGGGCAGGTGTCTCTGTGG + Intronic
1123028425 14:105439430-105439452 GTGGAGGCCAGGAGTGGCTGGGG - Intronic
1123067996 14:105627862-105627884 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091651 14:105744785-105744807 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091676 14:105744864-105744886 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091701 14:105744943-105744965 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091725 14:105745022-105745044 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091748 14:105745101-105745123 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123091772 14:105745180-105745202 GTGGGGGGCAGGAGTAGCAAGGG - Intergenic
1123091817 14:105745338-105745360 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123097401 14:105773056-105773078 GTGGGGGGCAGGAGGAGCAGGGG - Intergenic
1123632597 15:22272543-22272565 GTGAGGGGCAGCAGTCTCAGGGG + Intergenic
1126583692 15:50263060-50263082 GTGGAGGGCAGGACTTTGACTGG - Intronic
1126965861 15:54053072-54053094 ATGGATGGCAGAAGTTGCAGTGG - Intronic
1128383540 15:67130915-67130937 GTGGTGGGCAGCAATTGCAGAGG + Intronic
1129445277 15:75612740-75612762 GGGAAGGGTAGGTGTTTCAGGGG - Intronic
1129653304 15:77506654-77506676 GTGGCAGGCAGGAGTCTCAGAGG - Intergenic
1129670323 15:77604372-77604394 GCTGAGGGCAGGAGTGGCAGGGG - Intergenic
1130048134 15:80461738-80461760 ACGGATGGCACGAGTTTCAGAGG + Intronic
1131375161 15:91917112-91917134 GTGGCGGGCAGTGTTTTCAGTGG + Intronic
1132280027 15:100604505-100604527 GTGGAGGGCAGAAAGTCCAGTGG - Intronic
1132372901 15:101310281-101310303 GTGGAGGACAGGAGTTTCCTGGG - Intronic
1134001136 16:10783911-10783933 GTGGTTGCCAGGAGTTCCAGAGG + Intronic
1137578199 16:49617748-49617770 GGGGTGGGCAGCAGTGTCAGTGG - Intronic
1139761307 16:69186909-69186931 GTAGAGGTCAGGAGTTTCTGGGG + Intronic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1140599244 16:76455544-76455566 GTGGAGAGCAGAAGTTTAAAGGG - Intronic
1140808858 16:78557960-78557982 GTGCAGAGCAGGAATTTCATTGG + Intronic
1141970385 16:87477900-87477922 GTGAGGGGCAGCAGGTTCAGGGG - Intronic
1142157457 16:88539159-88539181 GAGGAGAGAAGGAGTTTCACAGG - Intergenic
1142359869 16:89620969-89620991 GTGAAGGGCGAGAGTCTCAGAGG + Intronic
1142577875 17:921413-921435 ATGGAAAGCAGCAGTTTCAGGGG - Intronic
1142845246 17:2669737-2669759 GGGAAGGGAAGGAGCTTCAGAGG - Intronic
1143854898 17:9841381-9841403 GTGAGGGGCAGGACTGTCAGAGG + Intronic
1144451269 17:15381315-15381337 GTTGAGAGCAAGAGTTTTAGAGG + Intergenic
1144859810 17:18294084-18294106 GGGGCGGGGAGGAGTTTCACAGG + Intronic
1145998478 17:29117785-29117807 ATGGAGGGCTGGGGGTTCAGAGG - Intronic
1146074635 17:29716832-29716854 GAGTGGGGGAGGAGTTTCAGAGG - Intronic
1148193608 17:45697783-45697805 GAGGAGGGGAGGAGCTTCTGAGG - Intergenic
1148293364 17:46476876-46476898 GTGGAGACCAAGAATTTCAGTGG + Intergenic
1148315550 17:46694579-46694601 GTGGAGACCAAGAATTTCAGTGG + Exonic
1148469798 17:47885817-47885839 GTGGAGCCTTGGAGTTTCAGAGG + Intergenic
1148633271 17:49128468-49128490 TTTGAAGGAAGGAGTTTCAGGGG + Intergenic
1151756792 17:76079848-76079870 GTGGAGAGCAGGAGCCTCAGTGG + Intronic
1152231294 17:79115343-79115365 GTGGAGGGCAGGCCTTTTACGGG - Intronic
1152433590 17:80262178-80262200 GTGGAGGGGAGGAGGTACGGTGG + Intronic
1152546608 17:81003579-81003601 CTGGCGGGAGGGAGTTTCAGGGG - Intronic
1153690611 18:7589545-7589567 GTGGTGGGGGGGAGTTGCAGGGG - Intronic
1154199545 18:12289759-12289781 GTGAAGGGCAGAAGTCCCAGAGG + Intergenic
1154254241 18:12768713-12768735 GTGGTGGACAGGAATTACAGCGG + Intergenic
1155873838 18:31060475-31060497 GTGGCGGCCAGGAGCTTCAGAGG - Exonic
1157237862 18:45981098-45981120 CTGGAAGGCAGGAGTTTCCCTGG + Intergenic
1157604430 18:48916985-48917007 GTGGAGGGCTGGGGACTCAGGGG + Intergenic
1158282063 18:55839091-55839113 GAAGAGGGCAGTAGATTCAGCGG + Intergenic
1158388408 18:57021143-57021165 GTGGTGGGAAGGCTTTTCAGGGG + Intronic
1159566787 18:70060207-70060229 GTGGAGGTCAGGAGTAGTAGGGG - Intronic
1161089076 19:2351323-2351345 GTGGAGGGCAGGGGTGTGCGAGG - Intronic
1161379184 19:3955745-3955767 GTGGCGTGCAGCAGCTTCAGGGG - Intergenic
1161590471 19:5127085-5127107 GTGGAGGGAAGGTGTCACAGCGG - Intronic
1163295198 19:16407244-16407266 GAGTAGGGCAGGAGCTTCTGAGG - Intronic
1163555485 19:17989983-17990005 GTGGATGGGAGGATCTTCAGAGG + Intronic
1163587743 19:18173236-18173258 GTCGGGGTCAGGAGTTTGAGGGG + Intronic
1163689626 19:18731550-18731572 TTGGTGGACATGAGTTTCAGGGG + Intronic
1164494431 19:28746389-28746411 GTGGATGGAAGCAGTTTCTGGGG - Intergenic
1164552511 19:29223434-29223456 GTGGAGGGCGGGAAGATCAGGGG - Intergenic
1164709948 19:30348689-30348711 GAGCAGGGCAGGAGCTGCAGTGG + Intronic
1164753058 19:30670236-30670258 CAGGAGGGGAGGAGTCTCAGAGG - Intronic
1164753195 19:30670990-30671012 GGGGAGGGGAGGAGTCTCAGGGG - Intronic
1168120002 19:54246623-54246645 CTTGAGCCCAGGAGTTTCAGAGG - Intronic
925034284 2:673879-673901 GTGGAGGGCTGACGTTACAGGGG + Intronic
926166191 2:10523185-10523207 GTGGAGGGCAGCAGCTACAAGGG + Intergenic
926313849 2:11695408-11695430 TTGGAGGAAAGGAGTTGCAGGGG + Intronic
927073653 2:19554935-19554957 ATGTAGAGCTGGAGTTTCAGAGG - Intergenic
927874678 2:26647527-26647549 GTGCAGGGCAGGAGTGCCCGAGG + Intergenic
931757316 2:65385518-65385540 GTGGAGGGGAGGCGTGGCAGAGG + Intronic
932213236 2:69948790-69948812 CGGGAGGGCAGGATTTACAGGGG - Intergenic
932625929 2:73295881-73295903 GAGGAGGGGAGGAGTTTGACTGG + Intergenic
933945663 2:87284139-87284161 CTGGAGGGCAGGAGCCTCAAAGG - Intergenic
935009954 2:99125020-99125042 GTGGAGCACAGGATTTTTAGGGG - Intronic
935838431 2:107080382-107080404 GAGGGAGGCAGGAGTGTCAGAGG + Intergenic
936334550 2:111577447-111577469 CTGGAGGGCAGGAGCCTCAAAGG + Intergenic
937365408 2:121257479-121257501 GTGGAGGGCAGGAGGGGCAAGGG - Intronic
938069542 2:128301105-128301127 GTGAGGGGCAGGGGTTTCTGGGG + Intronic
938137458 2:128770780-128770802 CAGGAGGGCAGGAGGTGCAGCGG + Intergenic
938624662 2:133095094-133095116 GTGGAGGTCAGAAGTCTCAGTGG - Intronic
938765916 2:134460354-134460376 GTGGAGGGGAGGAAGTTTAGGGG - Intronic
940875129 2:158890806-158890828 GTGGAAGGCAGGAACTCCAGGGG + Intergenic
942715110 2:178882853-178882875 GTGGAGGGCAGGGAGTTGAGGGG + Intronic
943549954 2:189326316-189326338 GGGGAGGGAAGCAGCTTCAGAGG + Intergenic
944089707 2:195892780-195892802 GTGGAGCACAGGATTTTTAGGGG - Intronic
944155112 2:196599475-196599497 GTGGGAGGGAGGAGGTTCAGTGG + Intergenic
945069008 2:205972556-205972578 CTTGAGGCCAGGAGTTTCAGAGG + Intergenic
945305317 2:208254429-208254451 GTGGAGGGGCGGAGCTCCAGCGG - Intronic
948493018 2:238326055-238326077 GTTTAGGGAAGGAGTTTCAGTGG + Intronic
1170064689 20:12298803-12298825 GTGGAGGGCTGGGGTTTGGGTGG + Intergenic
1170415566 20:16135336-16135358 CTGGAGGGGAGGATTTTTAGAGG - Intergenic
1170589702 20:17762536-17762558 GTGCAGGGCAGGTGTCTGAGGGG + Intergenic
1171129750 20:22640670-22640692 GTGGCTGGCAGGAGTATGAGTGG + Intergenic
1174078867 20:47957100-47957122 GTGGAGGCCAGGGGCTCCAGGGG - Intergenic
1174230951 20:49045258-49045280 GAGGAGGGCAGGGGTTTAGGAGG + Intergenic
1175498034 20:59428738-59428760 GTGGAGGAAAGGAGTTACCGAGG + Intergenic
1176669404 21:9718313-9718335 GTTGAGTGCAGGAGGTTCTGTGG + Intergenic
1177791160 21:25723218-25723240 GTGGAGGAGAGCTGTTTCAGGGG + Intronic
1178031360 21:28530059-28530081 GTGGAACGCAGGATTTTTAGGGG - Intergenic
1178393196 21:32216031-32216053 ATGGAGGAGAGGAGTTTTAGAGG - Intergenic
1179904555 21:44415552-44415574 CTGGAGGTCAGGAGTCTCACTGG - Intronic
1180953113 22:19729640-19729662 CTGAAGGGCAGGAGCTGCAGAGG + Intergenic
1181278115 22:21699462-21699484 GTGGAGGGCAGGTGGATGAGTGG + Exonic
1181718665 22:24756196-24756218 GTGGGGGGCTGAAGTTTCAAAGG + Intronic
1182422423 22:30254870-30254892 GTGGAGGGGAGGAGGCTAAGTGG + Intergenic
1183456801 22:37927293-37927315 GTGGAGGGCTTGGGTTTCTGGGG + Intronic
1184087630 22:42274660-42274682 CTGGAGAGCAGAAGTTTCTGTGG - Intronic
1184810291 22:46826744-46826766 GATGAGGACATGAGTTTCAGAGG + Intronic
1185246636 22:49776382-49776404 CTGGAGGGCAGGAGCTTCCCTGG - Intronic
951960902 3:28319143-28319165 GGGGAGGGCAGAGGTTTCAAGGG - Intronic
953317440 3:41942019-41942041 GTGGAGGGCAGGACTTTGAGAGG - Intronic
958730937 3:97959400-97959422 TTGGAGCCCAGGAGTTTGAGAGG - Intronic
959565255 3:107826634-107826656 GGGGAGGTCAGGAATGTCAGAGG - Intergenic
961031037 3:123604238-123604260 GGAGAGGGCTGGAGTTTCAAAGG + Intergenic
962256151 3:133871608-133871630 GTGGAGGGAGGCAGTGTCAGTGG - Intronic
962935957 3:140080989-140081011 GTGGAGTGAAGGATATTCAGAGG - Intronic
963040591 3:141066814-141066836 CTGGGGGGCAGGGCTTTCAGAGG + Intronic
963503080 3:146152991-146153013 GTGGCCGGCAGGAATTCCAGAGG + Intronic
963878551 3:150503188-150503210 GTGGTGGGGATGAGTGTCAGAGG - Intergenic
964305218 3:155332457-155332479 TTTGAGGGGAGCAGTTTCAGAGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967381422 3:188863418-188863440 GTGGAGAGCATGAGATGCAGAGG - Intronic
968489083 4:880595-880617 GTGGAGGCCAGGTGTCTCAGTGG - Intronic
968555684 4:1245479-1245501 GTGGCTGGCAGGAGCCTCAGAGG - Intronic
969177186 4:5407634-5407656 ATGGATGGCAGGAGTTTGGGGGG + Intronic
970167010 4:13249350-13249372 ATGGAGGAGAGGACTTTCAGAGG + Intergenic
970973606 4:22015789-22015811 GTGGAGGCAAGGAGTATCAGAGG + Intergenic
975273419 4:72465639-72465661 GTGCAGGACAGGGGTTTTAGGGG + Intronic
975342398 4:73257805-73257827 GTGGAGGGGAGCAGTTTGAGGGG - Intronic
975461733 4:74661311-74661333 CTGTAGGTCAGGGGTTTCAGAGG - Intergenic
975872612 4:78797203-78797225 GGGTAGGGCCGGAGTTTCTGTGG + Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
976825447 4:89255573-89255595 GTGGGGGGCAGGTGTGTCAGTGG + Intronic
978328463 4:107586081-107586103 CTGGAAGGCAGAAGTTGCAGTGG + Intergenic
983035031 4:162853182-162853204 ATGGATGGCAGCAGTTTGAGGGG + Intergenic
985303305 4:188512569-188512591 ATTTAGGGCAGGAGTTTTAGTGG + Intergenic
985689292 5:1298330-1298352 GAGGCGGGCAGGAGGGTCAGAGG - Intergenic
985728200 5:1526579-1526601 GGAGTGGGCAGGAGTTACAGAGG + Intergenic
986286779 5:6365131-6365153 GTGGAGGGCAGGGGGTACTGAGG - Intergenic
986608553 5:9545941-9545963 GTGGAGGGCCGGGGCTGCAGCGG + Exonic
987195021 5:15517630-15517652 GTGGATGGCAGGAGAGTCTGTGG + Intronic
988066829 5:26235452-26235474 GTGGTGGGCAGGTGTTGTAGTGG + Intergenic
988066929 5:26235817-26235839 GTGGTGGGCAGGTGTTTTGGTGG + Intergenic
988066936 5:26235849-26235871 GTGGTGGGCAGGTGTTGTAGTGG + Intergenic
988067018 5:26236167-26236189 GTGGTGGGCAGGTGTTGTAGTGG + Intergenic
988418312 5:30974452-30974474 GAGGAGGGAAGGAGTTGCAGAGG - Intergenic
988548152 5:32176504-32176526 TTTGAGGGGAGGAGTATCAGAGG - Intergenic
990285008 5:54292409-54292431 GTGGAGGGCAGGAGTTTCAGTGG - Intronic
990977566 5:61572926-61572948 CTGGAGCGCAGGAGTGGCAGGGG + Intergenic
991105109 5:62834406-62834428 GTGGAGGTCAGAAACTTCAGAGG + Intergenic
993602870 5:89950363-89950385 GTGGAGTGCAGGAGTTGAAATGG + Intergenic
994289829 5:98015510-98015532 TTGGAAGGCAGAAGTTGCAGTGG - Intergenic
994850130 5:105044192-105044214 GGGGAGGGCAGGAGTGACAAAGG + Intergenic
999053846 5:148552515-148552537 GTGGAAGAGATGAGTTTCAGGGG - Intronic
999771882 5:154782313-154782335 TTGGAGGCCAGGAGCTTTAGTGG + Intronic
1000318567 5:160116271-160116293 CTTGAGCGCAGGAGTTCCAGAGG - Intronic
1000944176 5:167400269-167400291 GTGGAGGAGGGAAGTTTCAGAGG + Intronic
1001085348 5:168696448-168696470 GTGGAGAGCAGGGGAGTCAGGGG + Intronic
1001141936 5:169151738-169151760 GAGGAAGGCAGGCCTTTCAGAGG - Intronic
1001515758 5:172354202-172354224 GTGGCGCTGAGGAGTTTCAGAGG - Intronic
1001932393 5:175682700-175682722 GTGGAGGGCAGGAGCTGAAAAGG - Exonic
1001953549 5:175832686-175832708 GGAGAGGGCAGGAATCTCAGGGG + Intronic
1002357995 5:178646451-178646473 GTGAAAGGCAGGAGTGTAAGAGG - Intergenic
1002466181 5:179410023-179410045 GTGGAGGCCAGGAGGGTCTGAGG + Intergenic
1003138633 6:3453859-3453881 GGTGAGTGCAGGAGTTCCAGGGG - Intronic
1003352568 6:5331831-5331853 GAGTAGGGCAGTAGGTTCAGGGG - Intronic
1003373726 6:5554137-5554159 AAGGAAGGAAGGAGTTTCAGCGG - Intronic
1004231377 6:13836595-13836617 GTGGAGGCATCGAGTTTCAGGGG + Intergenic
1005480205 6:26248344-26248366 GTGGAGGACAGAAGGTACAGGGG + Intergenic
1006341371 6:33448912-33448934 GTGGAGGGCAGCAGTGAGAGGGG - Intronic
1006611746 6:35298195-35298217 CTGGAGGCCAGGAGGTTCTGAGG + Intronic
1006758319 6:36437360-36437382 GTGGAGGGCAGGACCTTTACAGG - Intronic
1006817901 6:36865542-36865564 GTACAGGGCAGGAGTGACAGAGG - Intronic
1007335196 6:41150633-41150655 GGGGAGGGAAGGAGATTCAATGG - Intronic
1007628215 6:43258466-43258488 GAGGTGGGCAGGGGCTTCAGGGG + Intronic
1008602609 6:53110579-53110601 TTGGAGGGAGGGAGTTACAGAGG - Intergenic
1018383285 6:163280262-163280284 GTGCAGAGCAGGACGTTCAGAGG - Intronic
1018383429 6:163281216-163281238 GTGCAGAGCAGGACGTTCAGAGG + Intronic
1019884506 7:3892395-3892417 CTGGAGGGCAGGAGCTCCGGAGG + Intronic
1021781562 7:24111959-24111981 GTAGAGGGAAAGACTTTCAGAGG - Intergenic
1021783882 7:24133797-24133819 GATGAGGGCAGGAGCTTTAGGGG + Intergenic
1023068328 7:36402184-36402206 CTGGAAGGCAGAAGTTGCAGTGG - Intronic
1023173195 7:37409841-37409863 CTAGATGGCAGGAGTTTCACAGG + Intronic
1023459578 7:40380413-40380435 GTGGAGGAGAGGATTTTCGGAGG + Intronic
1024682172 7:51703545-51703567 GTGGATGGCAGGAGGTTGACTGG + Intergenic
1024746377 7:52411292-52411314 TTGGAGAGCAGAAGTTTCTGGGG + Intergenic
1024907018 7:54394727-54394749 CTGGTGGGGATGAGTTTCAGGGG + Intergenic
1026262781 7:68770155-68770177 CTTGAGGTCAGGAGTTCCAGAGG + Intergenic
1026371187 7:69701249-69701271 GTACAGGGCAGTGGTTTCAGAGG + Intronic
1026476374 7:70739394-70739416 CTTGAGGCCAGGAGTTTGAGAGG - Intronic
1026550315 7:71362920-71362942 GTGGAGGGCAACATGTTCAGGGG - Intronic
1026928106 7:74207685-74207707 GTGGACGGCACGAGTGTCAGAGG + Intronic
1027189576 7:75989076-75989098 GTGGAGGGGTGGAGGTTGAGGGG + Intronic
1028107435 7:86896476-86896498 ATGAAGGGCAGGAGCTTGAGAGG - Intronic
1029606415 7:101601878-101601900 GGGGAGGGCGGGATATTCAGGGG - Intergenic
1029723228 7:102384129-102384151 CTTGAGGTCAGGAGTTTGAGAGG + Intronic
1034005807 7:147470796-147470818 GTGGAGGGCAGGTAATTTAGAGG + Intronic
1034952905 7:155313090-155313112 GTAGAGTGGATGAGTTTCAGTGG + Intergenic
1035365409 7:158346253-158346275 GTGGAGGGCACAAATCTCAGGGG - Intronic
1035375740 7:158405405-158405427 GTGAAAGGCAAGATTTTCAGAGG - Intronic
1035628592 8:1091810-1091832 GGCGAGGGCAGGAATTACAGGGG - Intergenic
1037291027 8:17349574-17349596 GTGGAGGGCAGGAGTGTCCGGGG - Intronic
1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG + Intergenic
1039966791 8:42289842-42289864 GTGGAGGGCATGAGATTGAAAGG + Intronic
1042067754 8:64897631-64897653 GTGAAGGGGAGGAGTTACGGAGG + Intergenic
1042422300 8:68605960-68605982 GTGGGGGGCAGGAGGTACACAGG + Intronic
1042737556 8:72005513-72005535 GTGGAGGGCAGTTTTTTCAGTGG + Intronic
1042974582 8:74453072-74453094 CTGGAGTTCTGGAGTTTCAGTGG + Intronic
1043322695 8:79009464-79009486 ATGGAGGGCAGGAGGTGAAGGGG - Intergenic
1043867392 8:85391386-85391408 GTAGAAGGAGGGAGTTTCAGAGG - Intronic
1044114013 8:88312052-88312074 GTGGTGGGAAGTAGTGTCAGAGG + Intronic
1044866253 8:96574022-96574044 GTGGAGGGGAGGGGGTGCAGAGG - Intronic
1046499470 8:115057032-115057054 GAGGTGGACAGCAGTTTCAGAGG - Intergenic
1046796695 8:118381235-118381257 GTGGAGGTCTGAAGATTCAGTGG + Intronic
1047749698 8:127870993-127871015 AGGGAGGGCAGGAAGTTCAGAGG + Intergenic
1048955809 8:139535012-139535034 TTGGAGTGCAGGCATTTCAGCGG + Intergenic
1049283699 8:141763274-141763296 GGGGAGGTCAGGAGGTTAAGAGG + Intergenic
1049829093 8:144688319-144688341 CTTGAGGTCAGGAGTTTGAGAGG - Intergenic
1050176117 9:2871195-2871217 CTTGAGGCCAGGAGTTTAAGAGG - Intergenic
1050662569 9:7898888-7898910 CTGGAGGTCAGAAGTTTCAATGG - Intergenic
1053473432 9:38363742-38363764 GTGGAGGTCAGAAGTGTCAATGG + Intergenic
1055389978 9:75809921-75809943 ATGGAGGAAAGGATTTTCAGAGG - Intergenic
1056231521 9:84550424-84550446 GTGGAAGGCAACATTTTCAGTGG - Intergenic
1056616213 9:88168236-88168258 CTGGAGGTCAGGAGTTTGAGGGG + Intergenic
1057075480 9:92136119-92136141 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
1057273008 9:93661077-93661099 TTGGAGGGGAGGGGGTTCAGGGG + Intronic
1057411411 9:94819400-94819422 GTGGCGGGCAGGAGTTGCCCTGG - Intronic
1057507468 9:95647762-95647784 AGGGAGGGCAGATGTTTCAGAGG - Intergenic
1057928312 9:99171676-99171698 ATGGAAGTCAGGAGTTTCAGAGG - Intergenic
1058278464 9:103078751-103078773 AGGCAGGGGAGGAGTTTCAGTGG - Intergenic
1060038761 9:120281758-120281780 GTGGGGTGCATGAGTTTCTGTGG + Intergenic
1061131915 9:128713201-128713223 GAGTAGGGAAGGAGCTTCAGGGG + Intronic
1062664879 9:137664734-137664756 GTGGAGGGCAGGATTCTCTTGGG + Intronic
1203656463 Un_KI270753v1:2623-2645 GTTGAGTGCAGGAGGTTCTGTGG - Intergenic
1185970930 X:4662837-4662859 AAGGAGGGGAGGATTTTCAGAGG - Intergenic
1189396535 X:40628282-40628304 GTGGAGGGCAGGGGTTTATTTGG - Intronic
1189510688 X:41658306-41658328 TTGGTTGGCAGAAGTTTCAGCGG + Intronic
1190138862 X:47823180-47823202 GAGGAGGGCAGGAGGGTAAGAGG + Intergenic
1190916165 X:54812610-54812632 ATGAAGCGCAGGAGTGTCAGTGG + Intronic
1192442047 X:71181802-71181824 GTGAAGGGGTGGAGTTTCACTGG - Intergenic
1192783238 X:74314944-74314966 GTGGTCAGCAGGAGTTTCAGAGG + Intergenic
1193152251 X:78138242-78138264 GGGGAGGCCAGGAGTTTCCTGGG - Intronic
1195322275 X:103729465-103729487 GGGGAGGGGAGAAGTCTCAGAGG - Intergenic
1196270554 X:113705362-113705384 GTGGTTGCCAGGGGTTTCAGGGG - Intergenic
1197193892 X:123679044-123679066 GTGGAGAGCTGGTGTTACAGGGG - Intronic
1197283010 X:124559914-124559936 GTGGATGTCAGAAGTTTCATGGG + Intronic
1198012583 X:132573696-132573718 GTGCAGGGCAGGAGTTTGACAGG + Intergenic
1199651916 X:149953670-149953692 GTGGGAGGCAGGGGTTGCAGTGG - Intergenic
1199663514 X:150078304-150078326 GTGGTTGGCAGGAGTTTGAGGGG - Intergenic
1201281362 Y:12345277-12345299 GGGCAGGGCTGAAGTTTCAGAGG - Intergenic