ID: 990288175

View in Genome Browser
Species Human (GRCh38)
Location 5:54321611-54321633
Sequence CAGAACATACACACACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990288175_990288177 -10 Left 990288175 5:54321611-54321633 CCTTTGTGTGTGTGTATGTTCTG No data
Right 990288177 5:54321624-54321646 GTATGTTCTGGTACACGTTATGG No data
990288175_990288181 30 Left 990288175 5:54321611-54321633 CCTTTGTGTGTGTGTATGTTCTG No data
Right 990288181 5:54321664-54321686 TGTGGTACTATTAGACCTGCTGG No data
990288175_990288179 12 Left 990288175 5:54321611-54321633 CCTTTGTGTGTGTGTATGTTCTG No data
Right 990288179 5:54321646-54321668 GCTGACTGATGGTGTGCCTGTGG No data
990288175_990288178 1 Left 990288175 5:54321611-54321633 CCTTTGTGTGTGTGTATGTTCTG No data
Right 990288178 5:54321635-54321657 TACACGTTATGGCTGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990288175 Original CRISPR CAGAACATACACACACACAA AGG (reversed) Intergenic
No off target data available for this crispr